xho i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    XhoI
    Description:
    XhoI 25 000 units
    Catalog Number:
    r0146l
    Price:
    285
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs xho i
    XhoI
    XhoI 25 000 units
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 90 stars, based on 379 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers"

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-8-23

    Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.
    Figure Legend Snippet: Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Generated, Amplification, Transfection, Sequencing

    2) Product Images from "Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection"

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection

    Journal: DNA and Cell Biology

    doi: 10.1089/dna.2008.0792

    Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.
    Figure Legend Snippet: Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.

    Techniques Used: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Clone Assay, Expressing, Amplification, Infection, Purification, Transfection, Flow Cytometry, Cytometry, FACS, Isolation, Microscopy

    Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.
    Figure Legend Snippet: Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.

    Techniques Used: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Clone Assay, Expressing, Amplification, Infection, Purification, Transfection, Flow Cytometry, Cytometry, FACS, Isolation, Microscopy

    3) Product Images from "Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection"

    Article Title: Generation of Recombinant Vaccinia Viruses via Green Fluorescent Protein Selection

    Journal: DNA and Cell Biology

    doi: 10.1089/dna.2008.0792

    Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.
    Figure Legend Snippet: Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.

    Techniques Used: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Clone Assay, Expressing, Amplification, Infection, Purification, Transfection, Flow Cytometry, Cytometry, FACS, Isolation, Microscopy

    Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.
    Figure Legend Snippet: Strategy to generate insertion vector for rapid selection of rVVs. ( A ) The sequence of the mutated HIV clade C env gene, termed envC , was obtained by PCR (blue box) and cloned into the Xho I and Bam HI sites of the vector pIRES2-GFP. In the second step, the sequence of the expression cassette envC –IRES–GFP was PCR amplified and cloned into vector pCS59 (sites Xho I– Eco RI) under the control of strong synthetic early/late VV promoter (red box). Gray boxes, flanking sequences of the tk gene used for targeting the insertion vector and thereby disrupt the normal VV tk gene. As a consequence, rVVs containing the desired insert are no longer able to express thymidine kinase, and thus cells infected with rVVs become resistant to the toxic effects of BrdU. ( B ) Experimental protocol to accelerate the generation and purification of rVVs. First, 293T cells are exposed to wt VV, followed by transfection of the insertion vector encoding the gene of interest ( envC in our example). After 12 h, the GFP-positive cells are selected using flow cytometry. As an alternative to FACS sorting, rVVs can also be isolated by picking of green 293T cell plaques under a fluorescent microscope. After freezing and thawing, the GFP-positive 293T cell lysates are used to infect 143B Tk − cells in the presence of BrdU (the latter prevents replication of wt VV). To obtain pure clonal rVV stocks, several rounds of plaque purification can be performed. Finally, the amplified rVVs are collected and frozen in aliquots.

    Techniques Used: Plasmid Preparation, Selection, Sequencing, Polymerase Chain Reaction, Clone Assay, Expressing, Amplification, Infection, Purification, Transfection, Flow Cytometry, Cytometry, FACS, Isolation, Microscopy

    4) Product Images from "Cdc73 suppresses genome instability by mediating telomere homeostasis"

    Article Title: Cdc73 suppresses genome instability by mediating telomere homeostasis

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007170

    Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.
    Figure Legend Snippet: Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.

    Techniques Used: Southern Blot, Isolation, Derivative Assay, Nucleic Acid Electrophoresis, Labeling, Mutagenesis

    5) Product Images from "Characterization of Monoclonal Antibodies against HA Protein of H1N1 Swine Influenza Virus and Protective Efficacy against H1 Viruses in Mice"

    Article Title: Characterization of Monoclonal Antibodies against HA Protein of H1N1 Swine Influenza Virus and Protective Efficacy against H1 Viruses in Mice

    Journal: Viruses

    doi: 10.3390/v9080209

    The recombinant pCI-neo-HA identification by Nhe I/Xho I digestion. Lane 1 and 4: DNA molecular weight marker; lane 2: empty pCI-neo plasmid; lane 3: pCI-neo-HA plasmid digested with Nhe I and Xho I.
    Figure Legend Snippet: The recombinant pCI-neo-HA identification by Nhe I/Xho I digestion. Lane 1 and 4: DNA molecular weight marker; lane 2: empty pCI-neo plasmid; lane 3: pCI-neo-HA plasmid digested with Nhe I and Xho I.

    Techniques Used: Recombinant, Molecular Weight, Marker, Plasmid Preparation

    6) Product Images from "Cdc73 suppresses genome instability by mediating telomere homeostasis"

    Article Title: Cdc73 suppresses genome instability by mediating telomere homeostasis

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007170

    Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.
    Figure Legend Snippet: Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.

    Techniques Used: Southern Blot, Isolation, Derivative Assay, Nucleic Acid Electrophoresis, Labeling, Mutagenesis

    7) Product Images from "Adenovirus Type 4 Respiratory Infections among Civilian Adults, Northeastern United States, 2011–2015 1"

    Article Title: Adenovirus Type 4 Respiratory Infections among Civilian Adults, Northeastern United States, 2011–2015 1

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2402.171407

    In silico restriction enzyme analysis of human adenovirus type 4 genomes representing the spectrum of genetic variability of the 36 isolates characterized in study of acute respiratory infection detected in the northeastern United States, 2011–2015. We generated restriction enzyme profiles for the completely sequenced genomes obtained in this study and from reference sequences available in GenBank using Geneious Pro ( 31 ). 4p4 MIL is isolate NHR90339, 4a1 MIL is isolate NHRC3, and 4a2 MIL is isolate 42606; 4a Sma I v is isolate NY11 (GenBank accession no. KY996449) and 4a Sma I/ Xho I v is isolate NY24 (GenBank accession no. KY996446). MIL, military isolate; v, variant; Vac, vaccine strain.
    Figure Legend Snippet: In silico restriction enzyme analysis of human adenovirus type 4 genomes representing the spectrum of genetic variability of the 36 isolates characterized in study of acute respiratory infection detected in the northeastern United States, 2011–2015. We generated restriction enzyme profiles for the completely sequenced genomes obtained in this study and from reference sequences available in GenBank using Geneious Pro ( 31 ). 4p4 MIL is isolate NHR90339, 4a1 MIL is isolate NHRC3, and 4a2 MIL is isolate 42606; 4a Sma I v is isolate NY11 (GenBank accession no. KY996449) and 4a Sma I/ Xho I v is isolate NY24 (GenBank accession no. KY996446). MIL, military isolate; v, variant; Vac, vaccine strain.

    Techniques Used: In Silico, Infection, Generated, Variant Assay

    Related Articles

    Clone Assay:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites ( Not I and Xho I), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.).

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Paragraph title: Cloning and expression of recombinant GE MSP-2B. ... Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Paragraph title: Polygalacturonase gene cloning ... The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: .. For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. The digest product was purified by gel extraction (Qiagen, 28704) from a 0.7% agarose gel, as visualized on a white light table with crystal violet.

    Article Title: Modulation of flagellum attachment zone protein FLAM3 and regulation of the cell shape in Trypanosoma brucei life cycle transitions
    Article Snippet: For the FLAM3 RNAi-B plasmid, a 489-bp fragment of the ORF (nucleotides 5069–5557) was amplified and cloned into p2T7-177 ( ). .. Xho I (NEB) was used to linearise this plasmid.

    Centrifugation:

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. Recombinant MSP-2B was induced by growing the MZ-1-transformed clone to an A 550 of 1.0 at 30°C and then shifting the temperature to 38°C for an additional 2 h. Aliquots (1.5 ml) of preinduced and induced cells were pelleted by centrifugation and resuspended in 5× Laemmli buffer.

    Luciferase:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites ( Not I and Xho I), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.).

    DNA Ligation:

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. Ligation was performed with the Roche Rapid DNA ligation kit according to the instructions (Sigma-Aldrich, 11635379001) and transformed into laboratory-made, standard XL-10 Gold Escherichia coli via the New England Biolabs XL-10 heat shock protocol.

    Synthesized:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: Strains and plasmids The gene encoding for C. breweri SA MTase (Uniprot accession number: Q9SPV4 ), in addition to bases encoding for 6 N-terminal histidine residues, was codon-optimized for expression in E. coli , synthesized, and sub-cloned into the pET-15b expression vector using Nco I and Bam HI restriction sites (Genscript, USA). .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB).

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: A total of 4 oligonucleotides were synthesized based on dbSNP, the NCBI database of genetic variation, which consisted of the following parts (from 5′ to 3′): A Xho I sticky end (5 bp), a fragment from the 3′-UTR of the C14orf101 gene containing the GG or AA genotype (rs4901706; 47 bp), and a Not I sticky end (2 bp). .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis.

    Blocking Assay:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: The four oligonucleotides were incubated for 5 min with 1X NEBuffer 2 (New England Biolabs, Ipswich, MA, USA) in a heating block at 95°C. .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis.

    SYBR Green Assay:

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    IA:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: gBlock gene fragments, Gibson Assembly, and transformation The gBlock gene fragments encoding the library of TRGVs and TRDVs were obtained from Integrated DNA Technologies, Coralville, IA. .. The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction.

    Incubation:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: The four oligonucleotides were incubated for 5 min with 1X NEBuffer 2 (New England Biolabs, Ipswich, MA, USA) in a heating block at 95°C. .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis.

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: .. Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    Amplification:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. The 1,004-bp fragment was ligated into Nde I- and Xho I-digested pXA and transformed into E. coli MZ-1 ( ).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: Colony PCR amplification of the pglA gene (gene ID:1142827) was performed using Platinum taq polymerase (Invitrogen, Carlsbad, CA) and pglA specific primers XFPGF and XFPGRH with the following PCR parameters: 94°C (2 min) followed by 35 cycles of 94°C (1 min) 60°C (1 min) 72°C (2 min) and a final extension of 72°C (6 min). .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: One-twentieth of the cDNA reaction was used as source material for ORF amplification by Phusion PCR in 20-μl reactions with HF buffer, except for CHD7, which required GC buffer + 3% DMSO (Thermo Fisher, F530S). .. For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C.

    Article Title: Modulation of flagellum attachment zone protein FLAM3 and regulation of the cell shape in Trypanosoma brucei life cycle transitions
    Article Snippet: For the FLAM3 RNAi-B plasmid, a 489-bp fragment of the ORF (nucleotides 5069–5557) was amplified and cloned into p2T7-177 ( ). .. Xho I (NEB) was used to linearise this plasmid.

    In Silico:

    Article Title: Complete Genome Sequence of Treponema paraluiscuniculi, Strain Cuniculi A: The Loss of Infectivity to Humans Is Associated with Genome Decay
    Article Snippet: The Cuniculi A genomic sequence was used for simulated restriction digest in silico and these data were compared with experimentally obtained data. .. Altogether, 19 individual restriction enzymes were used including Acc I (194 verified restriction target sites), Asc I (2), Bam H I (222), Cla I (107), Eco R I (157), Eco R V (200), Hin d III (258), Kpn I (112), Mlu I (277), Mse I (8), Nco I (61), Nde I (1), Nhe I (14), Rsr II (20), Sac I (86), Spe I (25), Sph I (13), Xba I (68) or Xho I (191) enzymes (NEB) either alone or in combinations.

    Expressing:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: Strains and plasmids The gene encoding for C. breweri SA MTase (Uniprot accession number: Q9SPV4 ), in addition to bases encoding for 6 N-terminal histidine residues, was codon-optimized for expression in E. coli , synthesized, and sub-cloned into the pET-15b expression vector using Nco I and Bam HI restriction sites (Genscript, USA). .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB).

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Paragraph title: Cloning and expression of recombinant GE MSP-2B. ... Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Modification:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA was isolated from young tomato leaves (cv Moneymaker) as described by and modified by . .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Western Blot:

    Article Title: Nicotiana attenuata LECTIN RECEPTOR KINASE1 Suppresses the Insect-Mediated Inhibition of Induced Defense Responses during Manduca sexta Herbivory [C] Herbivory [C] [W]
    Article Snippet: The same 86-bp fragment used for generating the VIGS-lecRK1 vector was subcloned using Sac I and Xho I (New England Biolabs) restriction sites into the pSOL8 transformation vector ( ) as an inverted-repeat construct. .. T1 transformed plants were analyzed for T-DNA insertion number by DNA gel blot hybridization (see below).

    Transformation Assay:

    Article Title: A versatile toolkit for high throughput functional genomics with Trichoderma reesei
    Article Snippet: Vector construction and yeast mediated recombination The yeast shuttle vector pRS426 was digested with Eco RI and Xho I (restriction enzymes were purchased from New England Biolabs, Ontario, Canada) and purified with the E.Z.N.A. .. Yeast transformation and preparation was performed essentially as described previously [ , , ].

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. Subsequently, the ligated vectors were transformed in Escherichia coli -competent cells, as follows: Competent cells were taken from −80°C freezer and thawed on ice for 20 min. 1 µl of ligated vector was mixed into 100 µl of competent cells in a microcentrifuge.

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: Paragraph title: gBlock gene fragments, Gibson Assembly, and transformation ... The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. The 1,004-bp fragment was ligated into Nde I- and Xho I-digested pXA and transformed into E. coli MZ-1 ( ).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. Ligation was performed with the Roche Rapid DNA ligation kit according to the instructions (Sigma-Aldrich, 11635379001) and transformed into laboratory-made, standard XL-10 Gold Escherichia coli via the New England Biolabs XL-10 heat shock protocol.

    Article Title: Nicotiana attenuata LECTIN RECEPTOR KINASE1 Suppresses the Insect-Mediated Inhibition of Induced Defense Responses during Manduca sexta Herbivory [C] Herbivory [C] [W]
    Article Snippet: .. The same 86-bp fragment used for generating the VIGS-lecRK1 vector was subcloned using Sac I and Xho I (New England Biolabs) restriction sites into the pSOL8 transformation vector ( ) as an inverted-repeat construct. .. This construct was used to transform N. attenuata wild-type plants using Agrobacterium tumefaciens –mediated transformation and plant regeneration as previously described ( ).

    Hybridization:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Paragraph title: DNA Extraction and Southern Hybridization ... Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Article Title: Nicotiana attenuata LECTIN RECEPTOR KINASE1 Suppresses the Insect-Mediated Inhibition of Induced Defense Responses during Manduca sexta Herbivory [C] Herbivory [C] [W]
    Article Snippet: The same 86-bp fragment used for generating the VIGS-lecRK1 vector was subcloned using Sac I and Xho I (New England Biolabs) restriction sites into the pSOL8 transformation vector ( ) as an inverted-repeat construct. .. T1 transformed plants were analyzed for T-DNA insertion number by DNA gel blot hybridization (see below).

    Transfection:

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    Ligation:

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. Ligation was performed with the Roche Rapid DNA ligation kit according to the instructions (Sigma-Aldrich, 11635379001) and transformed into laboratory-made, standard XL-10 Gold Escherichia coli via the New England Biolabs XL-10 heat shock protocol.

    Protease Inhibitor:

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    Sequencing:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Primer sets were designed to contain restriction sites for cloning, a translation termination codon, and a six-residue histidine sequence for expressed protein purification (forward, 5′ CCGGCATATGCTTGTAGCTATGGAAGGC; reverse, 5′ CCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGAAAAGCAAACCTAACACCAAATTCCCC). .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. ..

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. Successful clones were confirmed by restriction analysis and thoroughly sequenced (primer sequences are available upon request; Ensemble Consensus CDS number Uniprot entry number) to ensure complete sequence identity for full-length CHD6 (CCDS13317.1 Q8TD26), CHD7 (CCDS47865.1 Q3L8U1).

    Article Title: Complete Genome Sequence of Treponema paraluiscuniculi, Strain Cuniculi A: The Loss of Infectivity to Humans Is Associated with Genome Decay
    Article Snippet: The Cuniculi A genomic sequence was used for simulated restriction digest in silico and these data were compared with experimentally obtained data. .. Altogether, 19 individual restriction enzymes were used including Acc I (194 verified restriction target sites), Asc I (2), Bam H I (222), Cla I (107), Eco R I (157), Eco R V (200), Hin d III (258), Kpn I (112), Mlu I (277), Mse I (8), Nco I (61), Nde I (1), Nhe I (14), Rsr II (20), Sac I (86), Spe I (25), Sph I (13), Xba I (68) or Xho I (191) enzymes (NEB) either alone or in combinations.

    Binding Assay:

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. Expression vector pXA is a pBR322-based vector containing the bacteriophage lambda pL promoter, a ribosome binding site, an ATG initiation codon, and transcription and translation termination signals.

    DNA Extraction:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Paragraph title: DNA Extraction and Southern Hybridization ... Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Molecular Cloning:

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: Paragraph title: Molecular cloning and protein bioinformatics ... For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C.

    Mutagenesis:

    Article Title: Enhancer scanning to locate regulatory regions in genomic loci
    Article Snippet: 11791-020) QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies; cat.no. .. R0146L and R0198L) Restriction endonuclease buffer NEB Buffer 3 (New England Biolabs; cat.no.

    Isolation:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA was isolated from young tomato leaves (cv Moneymaker) as described by and modified by . .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech).

    Subcloning:

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: PCR amplification of the first gene in pBluescript clone E46 was performed to generate an insert for subcloning in E. coli . .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Flow Cytometry:

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    Labeling:

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    Size-exclusion Chromatography:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The competent cell/DNA mixture was then placed on ice for 20–30 min and each transformation tube was heat shocked by placing the tube into a 42°C water bath for 90 sec.

    Protein Purification:

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Primer sets were designed to contain restriction sites for cloning, a translation termination codon, and a six-residue histidine sequence for expressed protein purification (forward, 5′ CCGGCATATGCTTGTAGCTATGGAAGGC; reverse, 5′ CCGGCTCGAGCTAGTGGTGGTGGTGGTGGTGAAAAGCAAACCTAACACCAAATTCCCC). .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Polymerase Chain Reaction:

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: The 100-μl reaction mix contained 500 ng of each primer, 500 ng of E46 template, and 1× PCR Supermix (Life Technologies). .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: The PCR product was purified with a PCR purification kit (Qiagen, 28104). .. For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C.

    Positron Emission Tomography:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Construct:

    Article Title: Nicotiana attenuata LECTIN RECEPTOR KINASE1 Suppresses the Insect-Mediated Inhibition of Induced Defense Responses during Manduca sexta Herbivory [C] Herbivory [C] [W]
    Article Snippet: .. The same 86-bp fragment used for generating the VIGS-lecRK1 vector was subcloned using Sac I and Xho I (New England Biolabs) restriction sites into the pSOL8 transformation vector ( ) as an inverted-repeat construct. .. This construct was used to transform N. attenuata wild-type plants using Agrobacterium tumefaciens –mediated transformation and plant regeneration as previously described ( ).

    cDNA Library Assay:

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech). .. Prehybridization, hybridization, washing, and detection were performed as described for cDNA library screening.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Enhancer scanning to locate regulatory regions in genomic loci
    Article Snippet: .. R0146L and R0198L) Restriction endonuclease buffer NEB Buffer 3 (New England Biolabs; cat.no. .. B7003S) Bovine Serum Albumin 1× (New England Biolabs; cat.no.

    Purification:

    Article Title: A versatile toolkit for high throughput functional genomics with Trichoderma reesei
    Article Snippet: .. Vector construction and yeast mediated recombination The yeast shuttle vector pRS426 was digested with Eco RI and Xho I (restriction enzymes were purchased from New England Biolabs, Ontario, Canada) and purified with the E.Z.N.A. .. Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, USA).

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites ( Not I and Xho I), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.).

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. The 1,004-bp fragment was ligated into Nde I- and Xho I-digested pXA and transformed into E. coli MZ-1 ( ).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: The PCR product was purified with a PCR purification kit (Qiagen, 28104). .. For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C.

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: .. Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    Plasmid Preparation:

    Article Title: A versatile toolkit for high throughput functional genomics with Trichoderma reesei
    Article Snippet: .. Vector construction and yeast mediated recombination The yeast shuttle vector pRS426 was digested with Eco RI and Xho I (restriction enzymes were purchased from New England Biolabs, Ontario, Canada) and purified with the E.Z.N.A. .. Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, USA).

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: .. The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. After gel/column purification (Qiagen), the fragments were ligated using T4 DNA ligase (NEB) and transformation carried out with NEB5-alpha competent cells.

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites ( Not I and Xho I), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.).

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: .. The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. Expression vector pXA is a pBR322-based vector containing the bacteriophage lambda pL promoter, a ribosome binding site, an ATG initiation codon, and transcription and translation termination signals.

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG. ..

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: .. For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. The digest product was purified by gel extraction (Qiagen, 28704) from a 0.7% agarose gel, as visualized on a white light table with crystal violet.

    Article Title: Enhancer scanning to locate regulatory regions in genomic loci
    Article Snippet: 632370) Gateway pDONR 221 vector (Life Technologies; cat.no. .. R0146L and R0198L) Restriction endonuclease buffer NEB Buffer 3 (New England Biolabs; cat.no.

    Article Title: Modulation of flagellum attachment zone protein FLAM3 and regulation of the cell shape in Trypanosoma brucei life cycle transitions
    Article Snippet: .. Xho I (NEB) was used to linearise this plasmid. .. For N-terminal endogenous tagging with PTP, a fragment (nucleotides 2-503) of the FLAM3 ORF was amplified and cloned into p2678 ( ).

    Article Title: Nicotiana attenuata LECTIN RECEPTOR KINASE1 Suppresses the Insect-Mediated Inhibition of Induced Defense Responses during Manduca sexta Herbivory [C] Herbivory [C] [W]
    Article Snippet: .. The same 86-bp fragment used for generating the VIGS-lecRK1 vector was subcloned using Sac I and Xho I (New England Biolabs) restriction sites into the pSOL8 transformation vector ( ) as an inverted-repeat construct. .. This construct was used to transform N. attenuata wild-type plants using Agrobacterium tumefaciens –mediated transformation and plant regeneration as previously described ( ).

    Software:

    Article Title: Complete Genome Sequence of Treponema paraluiscuniculi, Strain Cuniculi A: The Loss of Infectivity to Humans Is Associated with Genome Decay
    Article Snippet: Altogether, 19 individual restriction enzymes were used including Acc I (194 verified restriction target sites), Asc I (2), Bam H I (222), Cla I (107), Eco R I (157), Eco R V (200), Hin d III (258), Kpn I (112), Mlu I (277), Mse I (8), Nco I (61), Nde I (1), Nhe I (14), Rsr II (20), Sac I (86), Spe I (25), Sph I (13), Xba I (68) or Xho I (191) enzymes (NEB) either alone or in combinations. .. To ascertain the experimental error of WGF, the lengths of 250 individual DNA fragments in 5 fragment intervals (50 fragments per interval) including 0.2–0.5 kb, 0.5–1 kb, 1–2 kb, 2–3 kb, and 3–4 kb, respectively, were measured from agarose gels by AlphaView Software Version 3.0 (Alpha Innotech, San Leandro, CA) and calculated from in silico data.

    Recombinant:

    Article Title: Hydrogen Peroxide-Based Fluorometric Assay for Real-Time Monitoring of SAM-Dependent Methyltransferases
    Article Snippet: The amplified products and an in-house pET-28b-derived vector containing an N-terminal His tag-encoding sequence were doubly digested with Spe I (NEB) and Xho I (NEB). .. Recombinant plasmids were verified by restriction digestion and transferred to BL21(DE3) for protein expression.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: Paragraph title: Cloning and expression of recombinant GE MSP-2B. ... Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions.

    Agarose Gel Electrophoresis:

    Article Title: A polymorphism at the microRNA binding site in the 3′-untranslated region of C14orf101 is associated with the risk of gastric cancer development
    Article Snippet: .. The psiCheck-2 vector featuring the Renilla /luciferase and controlled firefly luciferase genes was linearized by digestion with Not I and Xho I (New England Biolabs), and the vector was then purified using a 1% agarose gel electrophoresis. .. The oligonucleotides were ligated in the linearized psiCheck-2 vector (Promega Corp.) into the cloning sites ( Not I and Xho I), which were downstream of the Renilla luciferase reporter gene with T4 DNA ligase (Promega Corp.).

    Article Title: Rapid cloning, expression, and functional characterization of paired αβ and γδ T-cell receptor chains from single-cell analysis
    Article Snippet: The expression vector pMICherry (10 μg), which was modified from the parental pMIGII by changing GFP to an mCherry reporter, was double digested by EcoR I (20 units) and Xho I (20 units) restriction enzymes (New England Biolabs) at 37 °C for 3 hours as per manufacturer’s instruction. .. Agarose gel purified-linearized pMICherry vector (100 ng) and 2× TCR gBlock inserts were ligated in a three-way ligation, including the TCRγ gene, TCRδ gene, and linearized vector by using the Gibson Assembly Cloning kit (New England Biolabs) per manufacturer’s instructions.

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. The 1,004-bp fragment was ligated into Nde I- and Xho I-digested pXA and transformed into E. coli MZ-1 ( ).

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. The digest product was purified by gel extraction (Qiagen, 28704) from a 0.7% agarose gel, as visualized on a white light table with crystal violet.

    Article Title: A Germination-Specific Endo-?-Mannanase Gene Is Expressed in the Micropylar Endosperm Cap of Tomato Seeds 1
    Article Snippet: .. Genomic DNA (10 μg) was digested with the restriction enzymes Bam HI, Xba I, and Xho I (New England Biolabs), separated on a 1.0% (w/v) agarose gel, and transferred to positively charged membranes (Hybond-N+ , Amersham Pharmacia Biotech). .. Prehybridization, hybridization, washing, and detection were performed as described for cDNA library screening.

    Concentration Assay:

    Article Title: Restriction Enzymes as a Target for DNA-Based Sensing and Structural Rearrangement
    Article Snippet: .. Enzyme Digestion All enzymes used (Bam HI, Eco RI, Nco I, Sma I, Xba I, and Xho I) were from New England Biolabs and had a concentration of 20 000 U/mL. ..

    Gel Extraction:

    Article Title: A versatile toolkit for high throughput functional genomics with Trichoderma reesei
    Article Snippet: Vector construction and yeast mediated recombination The yeast shuttle vector pRS426 was digested with Eco RI and Xho I (restriction enzymes were purchased from New England Biolabs, Ontario, Canada) and purified with the E.Z.N.A. .. Gel Extraction Kit (Omega Bio-Tek, Inc., Norcross, USA).

    Article Title: Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family
    Article Snippet: .. Following analysis on a 1% Tris-borate-EDTA agarose gel, amplified product was purified by using a QIAEX II gel extraction kit (Qiagen Inc., Chatsworth, Calif.) and digested with restriction enzymes Nde I and Xho I (New England Biolabs) under the manufacturer’s recommended conditions. .. The 1,004-bp fragment was ligated into Nde I- and Xho I-digested pXA and transformed into E. coli MZ-1 ( ).

    Article Title: Insights into the Activity and Substrate Binding of Xylella fastidiosa Polygalacturonase by Modification of a Unique QMK Amino Acid Motif Using Protein Chimeras
    Article Snippet: The resulting 1,635 bp PCR product was gel purified with the QIAquick gel extraction kit (Qiagen, Venlo, The Netherlands), cloned into pCR2.1 plasmid using the TOPO-TA cloning kit (Invitrogen, Carlsbad, CA) and transformed into E . coli TOP10 cells. .. The resulting plasmid, pCR2.1XFPG, was digested with Nde I and Xho I (NEB, Ipswich, MA) restriction enzymes and ligated with T4 DNA ligase (NEB, Ipswich, MA) into the Nde I and Xho I sites of pET30B (EMD Milipore, Billerica, MA) such that a 6X His tag sequence was present on the 3’ end of the gene, creating pET30BXFPG.

    Article Title: The ATP-dependent chromatin remodeling enzymes CHD6, CHD7, and CHD8 exhibit distinct nucleosome binding and remodeling activities
    Article Snippet: For cloning into a standard N-terminal FLAG-tagging pFastBac vector (Life Technologies), 2 μg of either insert (Phusion primers containing appropriate restriction sites) or vector were digested with 20 units of NotI, XhoI, or SalI as appropriate (New England Biolabs; R0189S, R0146S, and R0138S; enzymes can be deduced from cut sites in cloning primers) in 1× New England Biolabs buffer 3.1 overnight at 37 °C. .. The digest product was purified by gel extraction (Qiagen, 28704) from a 0.7% agarose gel, as visualized on a white light table with crystal violet.

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers
    Article Snippet: Linear DNA (l-DNA) Purified c-DNA was linearized using the restriction enzyme, Xho I (New England Biolabs; Pickering, ON) for pORF9-hTNFRS11b or Cla I (Invitrogen; Burlington, ON) for pEGFP-N2, Restriction digestion were set up with 5 μg of DNA per 50 μL of reaction volume containing 3 units of enzyme and incubated at 37°C for 16 hours. .. The enzyme was then heat-inactivated by incubating the mixture at 65°C for 10 min. Digested DNA was purified using QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON).

    Article Title: Structural Basis for Influenza Virus NS1 Protein Block of mRNA Nuclear Export
    Article Snippet: .. 50xAdvantage Polymerase mix (Clontech (EMD), 639202); dNTP’s (Clontech (EMD), 639125); BamHI-HF (New England Biolabs (NEB), R3136T); NotI (New England Biolabs (NEB), R0189S); SmaI (New England Biolabs (NEB), R0141); XhoI (New England Biolabs (NEB), R0146S); T4 DNA Ligase (New England Biolabs (NEB), M0202); QIAquick Gel Extraction Kit (Qiagen, 28704); NEB® 5-alpha Competent E. coli (New England Biolabs (NEB), ); Rosetta (DE3) Competent Cells (EMD Millipore, 70954); SOC Outgrowth Medium (New England Biolabs (NEB), B9020); QIAprep Spin Miniprep Kit (250) (Qiagen, 27106); Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, 13778150); RNeasy Plus Mini Kit (Qiagen, 74134); Random Hexamers (50 μM) (Thermo Fisher Scientific, N8080127); Protector RNase Inhibitor (Roche, 03335402001); SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064014); LIGHTCYCLER 480 SYBR GREEN I MASTER (Roche, 04707516001); LightCycler® 480 Multiwell Plate 96, White (Roche, 04729692001); NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific, 78833); Complete EDTA-free protease inhibitor tablets (Sigma-Aldrich, 11873580001); TransIT-X2® Dynamic Delivery System (Mirus Bio, MIR6000); SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34096); L-Glutathione reduced (Sigma-Aldrich, G4251–25G); Ampicillin (Sigma-Aldrich, A-9518); Kanamycin Monosulfate (Gold Biotechnology, K-120–10); IPTG (Gold Biotechnology, I2481C50); Imidazole (Sigma-Aldrich, 56750); PMSF (RPI, ); Aprotinin (Santa Cruz Biotechnology, sc-3595); Leupeptin (Santa Cruz Biotechnology, sc295358); Pepstatin A (Thermo Fisher Scientific, ); Glutathione Sepharose 4B (GE Healthcare, 17–0756-01); Amylose Resin (New England Biolabs (NEB), E8021S); Ni-NTA Agarose (Qiagen, 30210); Mono Q 5/50 GL (GE Healthcare, 17-5166-01); HiTrap SP HP (GE Healthcare, 17-1151-01); Superdex 200 HR 10/30 (GE Healthcare, 17-1088-01); EasyTag EXPRESS35 S Protein Labeling Mix, [35S]-, 7mCi (PerkinElmer, NEG772007MC); T7 RiboMAX™ Express Large Scale RNA Production System (Promega, P1320); Protein G Sepharose® 4 Fast Flow (GE Healthcare, 17-0618-01); Hoechst 33258 (Molecular Probes/Life Technologies); M mRNA probes (Biosearch Technologies) ; ProLong Gold antifade reagent (Life Technologies, ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs xho i
    Xho I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 379 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 90 stars, based on 379 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results