Structured Review

GE Healthcare α 32 p datp
Formation of TP-dAMP complex catalysed by Nf and GA-1 DNA polymerases. The assays were performed as described under Materials and Methods in the presence of 1 mM (for GA-1 and φ29 DNA polymerases) and 2 mM (for Nf DNA polymerase) MnCl 2 , 5 ng of TP, 500 ng of TP-DNA, 0.1 μM [α- 32 <t>P]dATP</t> (1 μCi), and the indicated amounts of DNA polymerase. After incubation at 30°C for the indicated times, samples were analysed by SDS–PAGE and autoradiography. The position of the TP-dAMP initiation complex is indicated. Quantification was by densitometry of the band corresponding to the labelled TP-dAMP complex, detected by autoradiography.
α 32 P Datp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α 32 p datp/product/GE Healthcare
Average 90 stars, based on 213 article reviews
Price from $9.99 to $1999.99
α 32 p datp - by Bioz Stars, 2020-04
90/100 stars

Images

1) Product Images from "Functional characterization of highly processive protein-primed DNA polymerases from phages Nf and GA-1, endowed with a potent strand displacement capacity"

Article Title: Functional characterization of highly processive protein-primed DNA polymerases from phages Nf and GA-1, endowed with a potent strand displacement capacity

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkl769

Formation of TP-dAMP complex catalysed by Nf and GA-1 DNA polymerases. The assays were performed as described under Materials and Methods in the presence of 1 mM (for GA-1 and φ29 DNA polymerases) and 2 mM (for Nf DNA polymerase) MnCl 2 , 5 ng of TP, 500 ng of TP-DNA, 0.1 μM [α- 32 P]dATP (1 μCi), and the indicated amounts of DNA polymerase. After incubation at 30°C for the indicated times, samples were analysed by SDS–PAGE and autoradiography. The position of the TP-dAMP initiation complex is indicated. Quantification was by densitometry of the band corresponding to the labelled TP-dAMP complex, detected by autoradiography.
Figure Legend Snippet: Formation of TP-dAMP complex catalysed by Nf and GA-1 DNA polymerases. The assays were performed as described under Materials and Methods in the presence of 1 mM (for GA-1 and φ29 DNA polymerases) and 2 mM (for Nf DNA polymerase) MnCl 2 , 5 ng of TP, 500 ng of TP-DNA, 0.1 μM [α- 32 P]dATP (1 μCi), and the indicated amounts of DNA polymerase. After incubation at 30°C for the indicated times, samples were analysed by SDS–PAGE and autoradiography. The position of the TP-dAMP initiation complex is indicated. Quantification was by densitometry of the band corresponding to the labelled TP-dAMP complex, detected by autoradiography.

Techniques Used: Incubation, SDS Page, Autoradiography

2) Product Images from "Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Replication and Transcription Activator Regulates Viral and Cellular Genes via Interferon-Stimulated Response Elements"

Article Title: Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Replication and Transcription Activator Regulates Viral and Cellular Genes via Interferon-Stimulated Response Elements

Journal: Journal of Virology

doi: 10.1128/JVI.79.9.5640-5652.2005

RTA binds to ISRE. A. The purified RTA protein binds to K14 ISRE. The probe was labeled with [α- 32 P]dATP. K14 ISRE, mK14 ISRE, ISG15 ISRE, Tap-2 ISRE, and mTap2-ISRE were used as cold competitors. Cold competitors were added at a 50-fold molar excess over hot probe. Various amounts of Ni 2+ -NTA agarose beads (1.5, 5, and 15 μl) were used to remove the histidine-tagged RTA proteins in an EMSA. Fifteen microliters of GST beads was used as a control. Rabbit polyclonal anti-RTA or K15 serum was also used. ns, nonspecific. B. RTA binds to known ISREs. The probe was ISRE-1 from the vIL-6 promoter. The cold competitors, Ni 2+ -NTA agarose beads, GST beads, and antisera used are shown. Specific protein-DNA complexes are shown.
Figure Legend Snippet: RTA binds to ISRE. A. The purified RTA protein binds to K14 ISRE. The probe was labeled with [α- 32 P]dATP. K14 ISRE, mK14 ISRE, ISG15 ISRE, Tap-2 ISRE, and mTap2-ISRE were used as cold competitors. Cold competitors were added at a 50-fold molar excess over hot probe. Various amounts of Ni 2+ -NTA agarose beads (1.5, 5, and 15 μl) were used to remove the histidine-tagged RTA proteins in an EMSA. Fifteen microliters of GST beads was used as a control. Rabbit polyclonal anti-RTA or K15 serum was also used. ns, nonspecific. B. RTA binds to known ISREs. The probe was ISRE-1 from the vIL-6 promoter. The cold competitors, Ni 2+ -NTA agarose beads, GST beads, and antisera used are shown. Specific protein-DNA complexes are shown.

Techniques Used: Purification, Labeling

3) Product Images from "Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci"

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci

Journal: Infection and Immunity

doi:

Northern hybridization with a specific probe for pfbp . The arrow indicates a transcription product of ca. 3.4 kb corresponding to the size of the whole pfbp gene. The probe was labeled with [α- 32 P]dATP and used at a concentration of 10 6 cpm/ml of hybridization solution. The sizes of the RNA molecular size markers are shown to the left. Small arrowheads on the left indicate the positions of the rRNAs on the stained agarose gel.
Figure Legend Snippet: Northern hybridization with a specific probe for pfbp . The arrow indicates a transcription product of ca. 3.4 kb corresponding to the size of the whole pfbp gene. The probe was labeled with [α- 32 P]dATP and used at a concentration of 10 6 cpm/ml of hybridization solution. The sizes of the RNA molecular size markers are shown to the left. Small arrowheads on the left indicate the positions of the rRNAs on the stained agarose gel.

Techniques Used: Northern Blot, Hybridization, Labeling, Concentration Assay, Staining, Agarose Gel Electrophoresis

4) Product Images from "Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE"

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE

Journal: Journal of Bacteriology

doi:

Southern blot analysis. Chromosomal DNAs were purified from E. coli CE1249 (lane a), BL21(DE3) (lane b), and BZB1107 (lane c), respectively, and digested with Eco RV. After fractionation of the DNA fragments by agarose gel electrophoresis, they were blotted onto a Hybond-N membrane and probed with [α- 32 P]dATP-labeled ompF -specific DNA. With strain BL21(DE3), two Eco RV fragments appeared in positions corresponding to ∼3.1 and 2.6 kb and are labeled by arrows as fragments I and II. Fragments corresponding to ompF (asterisk) and ompC (circle) are indicated. Hin dIII-digested λ DNA is shown in lane M.
Figure Legend Snippet: Southern blot analysis. Chromosomal DNAs were purified from E. coli CE1249 (lane a), BL21(DE3) (lane b), and BZB1107 (lane c), respectively, and digested with Eco RV. After fractionation of the DNA fragments by agarose gel electrophoresis, they were blotted onto a Hybond-N membrane and probed with [α- 32 P]dATP-labeled ompF -specific DNA. With strain BL21(DE3), two Eco RV fragments appeared in positions corresponding to ∼3.1 and 2.6 kb and are labeled by arrows as fragments I and II. Fragments corresponding to ompF (asterisk) and ompC (circle) are indicated. Hin dIII-digested λ DNA is shown in lane M.

Techniques Used: Southern Blot, Purification, Fractionation, Agarose Gel Electrophoresis, Labeling

5) Product Images from "Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA"

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA

Journal:

doi: 10.1016/j.bbrc.2007.08.118

Expression of human eNOS mRNA with long 3′-UTR in human tissues. (A) Northern blot were hybridized with [α- 32 P]dATP-labeled probes 239R and 511R for the detection of total eNOS mRNA and that with long 3′-UTR, respectively. 28s
Figure Legend Snippet: Expression of human eNOS mRNA with long 3′-UTR in human tissues. (A) Northern blot were hybridized with [α- 32 P]dATP-labeled probes 239R and 511R for the detection of total eNOS mRNA and that with long 3′-UTR, respectively. 28s

Techniques Used: Expressing, Northern Blot, Labeling

6) Product Images from "DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells"

Article Title: DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells

Journal: The EMBO Journal

doi: 10.1093/emboj/19.7.1731

Fig. 5. Inhibition of DNA-directed synthesis by non-complementary dNTPs. ( A ) Inhibition of [α– 32 P]dATP labelling of activated (gapped) DNA by addition of different concentrations of a mixture of dC, dG and dTTP, in the presence of 1 mM MnCl 2 (a scheme is depicted). Under the standard conditions described in Materials and methods, only dATP (13 nM) is used as substrate for this assay. After incubation for 15 min at 37°C in the presence of either TdT (2.5 U/41 ng), Klenow (1 U) or Pol μ (20 ng), and the concentration indicated of dNTPs, dAMP incorporation on activated DNA was expressed as a percentage of that obtained under standard assay conditions: 100% represents either 73 (TdT), 13 (Klenow) or 8 (Pol μ) fmol of incorporated dAMP. ( B ) A similar analysis was carried out, but using a poly(dT)/oligo(dA) hybrid to provide a homopolymeric template (dT)n. The assay was carried out in the presence of 1 mM MnCl 2 , 13 nM [α– 32 P]dATP as the correct nucleotide, either 20 ng of Pol μ (circles) or 1 U of Klenow (squares), and the concentration indicated (on the abscissa) of individual non-complementary dNTPs. After 5 min at 37°C, dAMP incorporation on poly(dT)/oligo(dA) was expressed as a percentage of that obtained when non-complementary nucleotides were added: 100% represents either 23 (Pol μ) or 127 (Klenow) fmol of incorporated dAMP.
Figure Legend Snippet: Fig. 5. Inhibition of DNA-directed synthesis by non-complementary dNTPs. ( A ) Inhibition of [α– 32 P]dATP labelling of activated (gapped) DNA by addition of different concentrations of a mixture of dC, dG and dTTP, in the presence of 1 mM MnCl 2 (a scheme is depicted). Under the standard conditions described in Materials and methods, only dATP (13 nM) is used as substrate for this assay. After incubation for 15 min at 37°C in the presence of either TdT (2.5 U/41 ng), Klenow (1 U) or Pol μ (20 ng), and the concentration indicated of dNTPs, dAMP incorporation on activated DNA was expressed as a percentage of that obtained under standard assay conditions: 100% represents either 73 (TdT), 13 (Klenow) or 8 (Pol μ) fmol of incorporated dAMP. ( B ) A similar analysis was carried out, but using a poly(dT)/oligo(dA) hybrid to provide a homopolymeric template (dT)n. The assay was carried out in the presence of 1 mM MnCl 2 , 13 nM [α– 32 P]dATP as the correct nucleotide, either 20 ng of Pol μ (circles) or 1 U of Klenow (squares), and the concentration indicated (on the abscissa) of individual non-complementary dNTPs. After 5 min at 37°C, dAMP incorporation on poly(dT)/oligo(dA) was expressed as a percentage of that obtained when non-complementary nucleotides were added: 100% represents either 23 (Pol μ) or 127 (Klenow) fmol of incorporated dAMP.

Techniques Used: Inhibition, Incubation, Concentration Assay

Fig. 2. Expression of human Pol μ in Escherichia coli . ( A ) Coomassie Blue staining after SDS–PAGE separation of control non-induced (NI) and IPTG-induced (I) extracts of E.coli BL21(DE3) cells transformed with the recombinant plasmid pRSET-hPolμ, and further purification steps of the latter extracts. The mobility of the induced protein Pol μ was compatible with its deduced molecular mass (55 kDa/494 amino acids). After PEI precipitation of the DNA, Pol μ was precipitated with 50% ammonium sulfate (AS), and purified further by phosphocellulose (PC) and heparin–Sepharose (HS) chromatography, as described in Materials and methods. The electrophoretic migration of a collection of molecular mass markers (MW) is shown at the left. ( B ) Relative activation by Mg 2+ versus Mn 2+ of TdT and Klenow enzymes during DNA polymerization ([α– 32 P]dATP labelling) on activated DNA. TdT (5 U) and Klenow (1 U) were assayed for 30 min at 37°C, in the presence of either 10 mM MgCl 2 or 1 mM MnCl 2 as a source of activating metal ions. DNA polymerase activity, expressed as dAMP incorporation, was quantitated as described in Materials and methods. ( C ) DNA polymerization activity associated with Pol μ expression. The 50% AS fraction corresponding to either non-induced (N.I.) or induced extracts was assayed and quantitated as described in ( B ).
Figure Legend Snippet: Fig. 2. Expression of human Pol μ in Escherichia coli . ( A ) Coomassie Blue staining after SDS–PAGE separation of control non-induced (NI) and IPTG-induced (I) extracts of E.coli BL21(DE3) cells transformed with the recombinant plasmid pRSET-hPolμ, and further purification steps of the latter extracts. The mobility of the induced protein Pol μ was compatible with its deduced molecular mass (55 kDa/494 amino acids). After PEI precipitation of the DNA, Pol μ was precipitated with 50% ammonium sulfate (AS), and purified further by phosphocellulose (PC) and heparin–Sepharose (HS) chromatography, as described in Materials and methods. The electrophoretic migration of a collection of molecular mass markers (MW) is shown at the left. ( B ) Relative activation by Mg 2+ versus Mn 2+ of TdT and Klenow enzymes during DNA polymerization ([α– 32 P]dATP labelling) on activated DNA. TdT (5 U) and Klenow (1 U) were assayed for 30 min at 37°C, in the presence of either 10 mM MgCl 2 or 1 mM MnCl 2 as a source of activating metal ions. DNA polymerase activity, expressed as dAMP incorporation, was quantitated as described in Materials and methods. ( C ) DNA polymerization activity associated with Pol μ expression. The 50% AS fraction corresponding to either non-induced (N.I.) or induced extracts was assayed and quantitated as described in ( B ).

Techniques Used: Expressing, Staining, SDS Page, Transformation Assay, Recombinant, Plasmid Preparation, Purification, Chromatography, Migration, Activation Assay, Activity Assay

7) Product Images from "Unphosphorylatable mutants of Cdc6 disrupt its nuclear export but still support DNA replication once per cell cycle"

Article Title: Unphosphorylatable mutants of Cdc6 disrupt its nuclear export but still support DNA replication once per cell cycle

Journal: Genes & Development

doi:

CDK phosphorylation of XCdc6 is not required for initiation of DNA replication. ( A ) Unphosphorylatable XCdc6 mutants do not inhibit DNA replication when added to interphase extracts at 10 ng/μL or 100ng/μL. Replication was measured by [α- 32 P]dATP incorporation after addition of buffer alone (+B), XCdc6 (+wt), either of the unphosphorylatable mutants (+M9, +M5), or interphase extract (+I). ( B,C ) Unphosphorylatable XCdc6 mutants rescue the replication of XCdc6-depleted extracts. Xenopus egg extract was depleted of endogenous XCdc6 and supplemented with buffer (+B), recombinant XCdc6 (+wt), either of the mutants (+M9, +M5), or interphase extract (+I). Proteins were added at a final concentration of 10 ng/μL. Replication was detected by either [α- 32 P]dATP ( B ) or biotin-dUTP incorporation ( C ). For confocal microscopy, nuclei were stained by propidium-iodide (red), and incorporated biotin was detected by fluorescein-linked streptavidin (green). Panels show merged images (red + green = yellow).
Figure Legend Snippet: CDK phosphorylation of XCdc6 is not required for initiation of DNA replication. ( A ) Unphosphorylatable XCdc6 mutants do not inhibit DNA replication when added to interphase extracts at 10 ng/μL or 100ng/μL. Replication was measured by [α- 32 P]dATP incorporation after addition of buffer alone (+B), XCdc6 (+wt), either of the unphosphorylatable mutants (+M9, +M5), or interphase extract (+I). ( B,C ) Unphosphorylatable XCdc6 mutants rescue the replication of XCdc6-depleted extracts. Xenopus egg extract was depleted of endogenous XCdc6 and supplemented with buffer (+B), recombinant XCdc6 (+wt), either of the mutants (+M9, +M5), or interphase extract (+I). Proteins were added at a final concentration of 10 ng/μL. Replication was detected by either [α- 32 P]dATP ( B ) or biotin-dUTP incorporation ( C ). For confocal microscopy, nuclei were stained by propidium-iodide (red), and incorporated biotin was detected by fluorescein-linked streptavidin (green). Panels show merged images (red + green = yellow).

Techniques Used: Recombinant, Concentration Assay, Confocal Microscopy, Staining

8) Product Images from "The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region"

Article Title: The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region

Journal: American Journal of Human Genetics

doi:

EMSAs of CTNS promoter region bearing −295 G→C mutation in patient 1. a, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive probe added. Lane 4, NE and 30-fold-molar excess nonspecific (calf thymus) DNA added. b, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, containing the −295 G→C mutation in patient 1, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. c, Results of Sp-1 oligonucleotide probe radiolabeled with γ[ 32 P]-ATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive Sp-1 oligonucleotide added. Lane 4, NE and 100-fold excess nonradioactive probe consisting of nucleotides −308 to −279 added. Lane 5, NE and 100-fold excess nonradioactive probe consisting of nucleotides −308 to −279, with the −295 G→C mutation in patient 1, added. d, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, Authentic Sp-1 peptide added. Lane 3, Sp-1 peptide and nonradioactive probe consisting of nucleotides −308 to −279 added. Lane 4, Sp-1 peptide and 30-fold-molar excess nonspecific (calf thymus) DNA added.
Figure Legend Snippet: EMSAs of CTNS promoter region bearing −295 G→C mutation in patient 1. a, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive probe added. Lane 4, NE and 30-fold-molar excess nonspecific (calf thymus) DNA added. b, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, containing the −295 G→C mutation in patient 1, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. c, Results of Sp-1 oligonucleotide probe radiolabeled with γ[ 32 P]-ATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive Sp-1 oligonucleotide added. Lane 4, NE and 100-fold excess nonradioactive probe consisting of nucleotides −308 to −279 added. Lane 5, NE and 100-fold excess nonradioactive probe consisting of nucleotides −308 to −279, with the −295 G→C mutation in patient 1, added. d, Results of double-stranded–DNA probe consisting of nucleotides −308 to −279, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, Authentic Sp-1 peptide added. Lane 3, Sp-1 peptide and nonradioactive probe consisting of nucleotides −308 to −279 added. Lane 4, Sp-1 peptide and 30-fold-molar excess nonspecific (calf thymus) DNA added.

Techniques Used: Mutagenesis

EMSAs of CTNS promoter region bearing mutations in patients 2 and 3. a, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive probe added. Lane 4, NE and 300-fold excess nonradioactive probe added. Lane 5, NE and 600-fold excess nonradioactive probe added. Lane 6, NE and 600-fold excess nonradioactive probe consisting of nucleotides −327 to −300, containing the −303 G→T mutation in patient 2, added. Lane 7, NE and 600-fold excess nonradioactive probe consisting of nucleotides −327 to −300, containing the −303 T insertion in patient 3, added. Arrows indicate the locations of DNA-protein complexes that can be competed against by the normal but not by the mutant oligonucleotides. b, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, containing the −303 G→T mutation in patient 2, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 600-fold excess nonradioactive mutant probe added. c, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, containing the T insertion after position −303 in patient 3, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 600-fold excess nonradioactive mutant probe added.
Figure Legend Snippet: EMSAs of CTNS promoter region bearing mutations in patients 2 and 3. a, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 100-fold excess nonradioactive probe added. Lane 4, NE and 300-fold excess nonradioactive probe added. Lane 5, NE and 600-fold excess nonradioactive probe added. Lane 6, NE and 600-fold excess nonradioactive probe consisting of nucleotides −327 to −300, containing the −303 G→T mutation in patient 2, added. Lane 7, NE and 600-fold excess nonradioactive probe consisting of nucleotides −327 to −300, containing the −303 T insertion in patient 3, added. Arrows indicate the locations of DNA-protein complexes that can be competed against by the normal but not by the mutant oligonucleotides. b, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, containing the −303 G→T mutation in patient 2, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 600-fold excess nonradioactive mutant probe added. c, Results of double-stranded DNA probe consisting of nucleotides −327 to −300, containing the T insertion after position −303 in patient 3, radiolabeled with α[ 32 P]-dATP. Lane 1, No addition. Lane 2, NE added. Lane 3, NE and 600-fold excess nonradioactive mutant probe added.

Techniques Used: Mutagenesis

9) Product Images from "Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a"

Article Title: Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Dnmt3a induces CpG, CpA, and CpT methylation in Drosophila . NNA of genomic DNA extracted from wild-type ( A , C , and E ) and Dnmt3a -transgenic ( B , D , and F ) Drosophila . ( A and B ) Fok I-digested DNAs labeled with [α- 32 P]dGTP. ( C and D ) Fok I-digested DNA labeled with [α- 32 P]dATP. ( E and F ) Mva I-digested DNAs labeled with [α- 32 P]dATP. In the Mva I experiments ( E and F ), a small amount of labeling Ap, Tp, and Gp can also be seen. This finding is attributable to background labeling at nicks in the DNA. The identities of the labeled nucleotides are shown in B and F .
Figure Legend Snippet: Dnmt3a induces CpG, CpA, and CpT methylation in Drosophila . NNA of genomic DNA extracted from wild-type ( A , C , and E ) and Dnmt3a -transgenic ( B , D , and F ) Drosophila . ( A and B ) Fok I-digested DNAs labeled with [α- 32 P]dGTP. ( C and D ) Fok I-digested DNA labeled with [α- 32 P]dATP. ( E and F ) Mva I-digested DNAs labeled with [α- 32 P]dATP. In the Mva I experiments ( E and F ), a small amount of labeling Ap, Tp, and Gp can also be seen. This finding is attributable to background labeling at nicks in the DNA. The identities of the labeled nucleotides are shown in B and F .

Techniques Used: Cycling Probe Technology, Methylation, Transgenic Assay, Labeling

10) Product Images from "Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2"

Article Title: Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2

Journal: Journal of Virology

doi:

Location of the transcription start sites in the cro-cI intergenic segment of phage A2 and role of CI in regulation of the P R promoter. B. subtilis ς A -RNAP (30 nM) and linearized pUO183 DNA (3 nM) were used for the in vitro generation of cI (lane 2) and cro (lane 3) runoff transcripts, and the resulting mRNAs were subjected to primer extension with reverse transcriptase in the presence of [α- 32 P]dATP. Maxam and Gilbert (G+A) sequencing reactions were used as size standards (lane 1). The sizes of the cDNAs obtained are indicated. Successive lanes show the effects of increasing concentrations of CI (3.7, 7.4, 29.6, 59.2, 118.5, 177, 237, and 474 nM, respectively) on cro -specific transcript generation.
Figure Legend Snippet: Location of the transcription start sites in the cro-cI intergenic segment of phage A2 and role of CI in regulation of the P R promoter. B. subtilis ς A -RNAP (30 nM) and linearized pUO183 DNA (3 nM) were used for the in vitro generation of cI (lane 2) and cro (lane 3) runoff transcripts, and the resulting mRNAs were subjected to primer extension with reverse transcriptase in the presence of [α- 32 P]dATP. Maxam and Gilbert (G+A) sequencing reactions were used as size standards (lane 1). The sizes of the cDNAs obtained are indicated. Successive lanes show the effects of increasing concentrations of CI (3.7, 7.4, 29.6, 59.2, 118.5, 177, 237, and 474 nM, respectively) on cro -specific transcript generation.

Techniques Used: In Vitro, Sequencing

11) Product Images from "Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci"

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci

Journal: Infection and Immunity

doi:

Northern hybridization with a specific probe for pfbp . The arrow indicates a transcription product of ca. 3.4 kb corresponding to the size of the whole pfbp gene. The probe was labeled with [α- 32 P]dATP and used at a concentration of 10 6 cpm/ml of hybridization solution. The sizes of the RNA molecular size markers are shown to the left. Small arrowheads on the left indicate the positions of the rRNAs on the stained agarose gel.
Figure Legend Snippet: Northern hybridization with a specific probe for pfbp . The arrow indicates a transcription product of ca. 3.4 kb corresponding to the size of the whole pfbp gene. The probe was labeled with [α- 32 P]dATP and used at a concentration of 10 6 cpm/ml of hybridization solution. The sizes of the RNA molecular size markers are shown to the left. Small arrowheads on the left indicate the positions of the rRNAs on the stained agarose gel.

Techniques Used: Northern Blot, Hybridization, Labeling, Concentration Assay, Staining, Agarose Gel Electrophoresis

12) Product Images from "DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer"

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer

Journal: Nucleic Acids Research

doi:

Sequence-selective binding. DNase I footprinting gel obtained with the 117 bp Pvu II– Eco RI restriction fragment in the presence of graded concentrations of AT2433-B1 and iso-AT2433-B1. The DNA was 3′-end-labeled at the Eco RI site with [α- 32 P]dATP in the presence of AMV reverse transcriptase. The products of nuclease digestion were resolved on an 8% polyacrylamide gel containing 7 M urea. Control tracks (Cont) contained no drug. Guanine-specific sequence markers obtained by treatment of the DNA with dimethylsulfate followed by piperidine were run in the lane marked G. Numbers on the left side of the gel refer to the standard numbering scheme for the nucleotide sequence of the DNA fragment, as indicated in Figure 3.
Figure Legend Snippet: Sequence-selective binding. DNase I footprinting gel obtained with the 117 bp Pvu II– Eco RI restriction fragment in the presence of graded concentrations of AT2433-B1 and iso-AT2433-B1. The DNA was 3′-end-labeled at the Eco RI site with [α- 32 P]dATP in the presence of AMV reverse transcriptase. The products of nuclease digestion were resolved on an 8% polyacrylamide gel containing 7 M urea. Control tracks (Cont) contained no drug. Guanine-specific sequence markers obtained by treatment of the DNA with dimethylsulfate followed by piperidine were run in the lane marked G. Numbers on the left side of the gel refer to the standard numbering scheme for the nucleotide sequence of the DNA fragment, as indicated in Figure 3.

Techniques Used: Sequencing, Binding Assay, Footprinting, Labeling

13) Product Images from "DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells"

Article Title: DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells

Journal: The EMBO Journal

doi: 10.1093/emboj/19.7.1731

Fig. 5. Inhibition of DNA-directed synthesis by non-complementary dNTPs. ( A ) Inhibition of [α– 32 P]dATP labelling of activated (gapped) DNA by addition of different concentrations of a mixture of dC, dG and dTTP, in the presence of 1 mM MnCl 2 (a scheme is depicted). Under the standard conditions described in Materials and methods, only dATP (13 nM) is used as substrate for this assay. After incubation for 15 min at 37°C in the presence of either TdT (2.5 U/41 ng), Klenow (1 U) or Pol μ (20 ng), and the concentration indicated of dNTPs, dAMP incorporation on activated DNA was expressed as a percentage of that obtained under standard assay conditions: 100% represents either 73 (TdT), 13 (Klenow) or 8 (Pol μ) fmol of incorporated dAMP. ( B ) A similar analysis was carried out, but using a poly(dT)/oligo(dA) hybrid to provide a homopolymeric template (dT)n. The assay was carried out in the presence of 1 mM MnCl 2 , 13 nM [α– 32 P]dATP as the correct nucleotide, either 20 ng of Pol μ (circles) or 1 U of Klenow (squares), and the concentration indicated (on the abscissa) of individual non-complementary dNTPs. After 5 min at 37°C, dAMP incorporation on poly(dT)/oligo(dA) was expressed as a percentage of that obtained when non-complementary nucleotides were added: 100% represents either 23 (Pol μ) or 127 (Klenow) fmol of incorporated dAMP.
Figure Legend Snippet: Fig. 5. Inhibition of DNA-directed synthesis by non-complementary dNTPs. ( A ) Inhibition of [α– 32 P]dATP labelling of activated (gapped) DNA by addition of different concentrations of a mixture of dC, dG and dTTP, in the presence of 1 mM MnCl 2 (a scheme is depicted). Under the standard conditions described in Materials and methods, only dATP (13 nM) is used as substrate for this assay. After incubation for 15 min at 37°C in the presence of either TdT (2.5 U/41 ng), Klenow (1 U) or Pol μ (20 ng), and the concentration indicated of dNTPs, dAMP incorporation on activated DNA was expressed as a percentage of that obtained under standard assay conditions: 100% represents either 73 (TdT), 13 (Klenow) or 8 (Pol μ) fmol of incorporated dAMP. ( B ) A similar analysis was carried out, but using a poly(dT)/oligo(dA) hybrid to provide a homopolymeric template (dT)n. The assay was carried out in the presence of 1 mM MnCl 2 , 13 nM [α– 32 P]dATP as the correct nucleotide, either 20 ng of Pol μ (circles) or 1 U of Klenow (squares), and the concentration indicated (on the abscissa) of individual non-complementary dNTPs. After 5 min at 37°C, dAMP incorporation on poly(dT)/oligo(dA) was expressed as a percentage of that obtained when non-complementary nucleotides were added: 100% represents either 23 (Pol μ) or 127 (Klenow) fmol of incorporated dAMP.

Techniques Used: Inhibition, Incubation, Concentration Assay

Fig. 2. Expression of human Pol μ in Escherichia coli . ( A ) Coomassie Blue staining after SDS–PAGE separation of control non-induced (NI) and IPTG-induced (I) extracts of E.coli BL21(DE3) cells transformed with the recombinant plasmid pRSET-hPolμ, and further purification steps of the latter extracts. The mobility of the induced protein Pol μ was compatible with its deduced molecular mass (55 kDa/494 amino acids). After PEI precipitation of the DNA, Pol μ was precipitated with 50% ammonium sulfate (AS), and purified further by phosphocellulose (PC) and heparin–Sepharose (HS) chromatography, as described in Materials and methods. The electrophoretic migration of a collection of molecular mass markers (MW) is shown at the left. ( B ) Relative activation by Mg 2+ versus Mn 2+ of TdT and Klenow enzymes during DNA polymerization ([α– 32 P]dATP labelling) on activated DNA. TdT (5 U) and Klenow (1 U) were assayed for 30 min at 37°C, in the presence of either 10 mM MgCl 2 or 1 mM MnCl 2 as a source of activating metal ions. DNA polymerase activity, expressed as dAMP incorporation, was quantitated as described in Materials and methods. ( C ) DNA polymerization activity associated with Pol μ expression. The 50% AS fraction corresponding to either non-induced (N.I.) or induced extracts was assayed and quantitated as described in ( B ).
Figure Legend Snippet: Fig. 2. Expression of human Pol μ in Escherichia coli . ( A ) Coomassie Blue staining after SDS–PAGE separation of control non-induced (NI) and IPTG-induced (I) extracts of E.coli BL21(DE3) cells transformed with the recombinant plasmid pRSET-hPolμ, and further purification steps of the latter extracts. The mobility of the induced protein Pol μ was compatible with its deduced molecular mass (55 kDa/494 amino acids). After PEI precipitation of the DNA, Pol μ was precipitated with 50% ammonium sulfate (AS), and purified further by phosphocellulose (PC) and heparin–Sepharose (HS) chromatography, as described in Materials and methods. The electrophoretic migration of a collection of molecular mass markers (MW) is shown at the left. ( B ) Relative activation by Mg 2+ versus Mn 2+ of TdT and Klenow enzymes during DNA polymerization ([α– 32 P]dATP labelling) on activated DNA. TdT (5 U) and Klenow (1 U) were assayed for 30 min at 37°C, in the presence of either 10 mM MgCl 2 or 1 mM MnCl 2 as a source of activating metal ions. DNA polymerase activity, expressed as dAMP incorporation, was quantitated as described in Materials and methods. ( C ) DNA polymerization activity associated with Pol μ expression. The 50% AS fraction corresponding to either non-induced (N.I.) or induced extracts was assayed and quantitated as described in ( B ).

Techniques Used: Expressing, Staining, SDS Page, Transformation Assay, Recombinant, Plasmid Preparation, Purification, Chromatography, Migration, Activation Assay, Activity Assay

14) Product Images from "The t(8;21) Fusion Product, AML-1-ETO, Associates with C/EBP-?, Inhibits C/EBP-?-Dependent Transcription, and Blocks Granulocytic Differentiation"

Article Title: The t(8;21) Fusion Product, AML-1-ETO, Associates with C/EBP-?, Inhibits C/EBP-?-Dependent Transcription, and Blocks Granulocytic Differentiation

Journal: Molecular and Cellular Biology

doi:

AML-1B, AML-2, AML-3, and C/EBP-α bind to NP-3 promoter sequences. (A) Schematic of the rat NP-3 promoter showing locations of core binding motifs (underlined), C/EBP binding sites, and reporter constructs used in this study. (B to D) Binding of AML family members to NP-3 promoter sequences determined by electrophoretic mobility shift assays. A 32 P-labeled annealed oligonucleotide probe containing the consensus core site, TGTGGT, was incubated with 3 μg of lysates from COS-7 cells overexpressing AML-1B (B), AML-2 (C), or mAML-3 (D) in the presence or absence of the indicated unlabeled competitor. The NP-3 promoter competitors were generated by PCR. (E and F) Binding of C/EBP-α to NP-3 promoter sequences. NP-3 promoter sequences extending −137 (E) and −87 (F) nucleotides from the transcription start site were labeled with [α- 32 P]dATP and incubated with 3 μg of C/EBP-α-overexpressing COS-7 cell lysates in the presence or absence of an unlabeled oligonucleotide containing the consensus C/EBP binding site. Supershift assays were performed with 1 μg of C/EBP-α antiserum. The location of the C/EBP-α–DNA complex is denoted by the arrows, and the supershifted complex is adjacent to the asterisks.
Figure Legend Snippet: AML-1B, AML-2, AML-3, and C/EBP-α bind to NP-3 promoter sequences. (A) Schematic of the rat NP-3 promoter showing locations of core binding motifs (underlined), C/EBP binding sites, and reporter constructs used in this study. (B to D) Binding of AML family members to NP-3 promoter sequences determined by electrophoretic mobility shift assays. A 32 P-labeled annealed oligonucleotide probe containing the consensus core site, TGTGGT, was incubated with 3 μg of lysates from COS-7 cells overexpressing AML-1B (B), AML-2 (C), or mAML-3 (D) in the presence or absence of the indicated unlabeled competitor. The NP-3 promoter competitors were generated by PCR. (E and F) Binding of C/EBP-α to NP-3 promoter sequences. NP-3 promoter sequences extending −137 (E) and −87 (F) nucleotides from the transcription start site were labeled with [α- 32 P]dATP and incubated with 3 μg of C/EBP-α-overexpressing COS-7 cell lysates in the presence or absence of an unlabeled oligonucleotide containing the consensus C/EBP binding site. Supershift assays were performed with 1 μg of C/EBP-α antiserum. The location of the C/EBP-α–DNA complex is denoted by the arrows, and the supershifted complex is adjacent to the asterisks.

Techniques Used: Binding Assay, Construct, Electrophoretic Mobility Shift Assay, Labeling, Incubation, Generated, Polymerase Chain Reaction

15) Product Images from "?29 DNA polymerase residues Tyr59, His61 and Phe69 of the highly conserved ExoII motif are essential for interaction with the terminal protein"

Article Title: ?29 DNA polymerase residues Tyr59, His61 and Phe69 of the highly conserved ExoII motif are essential for interaction with the terminal protein

Journal: Nucleic Acids Research

doi:

Abortive TP–(dNMP) n products accumulate for DNA polymerase mutants affected in TP binding. The assay was performed as described in Materials and Methods. Samples were analyzed by high resolution SDS–PAGE. The first left-most 10 nt of the Φ29 genome are depicted at the top. Samples contained 20 µM each [α- 32 P]dATP (1 µCi), dGTP and dTTP. Whereas the first series of samples (a) was stopped after incubation at 30°C for 5 min, dCTP was added to the second series of samples (b) for an additional 5 min incubation at 30°C. The length of different transition products and the position corresponding to full-length Φ29 TP–DNA are indicated.
Figure Legend Snippet: Abortive TP–(dNMP) n products accumulate for DNA polymerase mutants affected in TP binding. The assay was performed as described in Materials and Methods. Samples were analyzed by high resolution SDS–PAGE. The first left-most 10 nt of the Φ29 genome are depicted at the top. Samples contained 20 µM each [α- 32 P]dATP (1 µCi), dGTP and dTTP. Whereas the first series of samples (a) was stopped after incubation at 30°C for 5 min, dCTP was added to the second series of samples (b) for an additional 5 min incubation at 30°C. The length of different transition products and the position corresponding to full-length Φ29 TP–DNA are indicated.

Techniques Used: Binding Assay, SDS Page, Incubation

16) Product Images from "Production of Cry11A and Cry11Ba Toxins in Bacillus sphaericus Confers Toxicity towards Aedes aegypti and Resistant Culex Populations"

Article Title: Production of Cry11A and Cry11Ba Toxins in Bacillus sphaericus Confers Toxicity towards Aedes aegypti and Resistant Culex Populations

Journal: Applied and Environmental Microbiology

doi:

Southern blot analysis of total DNA from the wild-type strain and recombinant B. sphaericus strains. Total DNA from strains 2297 bin :: cry11A pro :: cry11Ba (lanes 1); 2297 (lanes 2); 2297 pro :: cry11Ba (lanes A3 and B3); 2297 pro :: cry11A (lanes A4 and D3); and 2297 pro :: aphA3 (lane A5). DNA was digested with Eco RI and subjected to electrophoresis in a 0.7% agarose gel. DNA fragments were transferred onto Hybond N + membranes and hybridized with [α- 32 P]dATP-labeled probes corresponding to the 5′ end of the protease gene (A), the internal part of cry11Ba (B), the 5′ end of the binary toxin operon (C), and the 5′ end of cry11A (D). The size of the reactive fragments was as expected. In part C, the existence of two copies of the binary toxin in strain 2297 led to the presence of the three bands observed in lane 1.
Figure Legend Snippet: Southern blot analysis of total DNA from the wild-type strain and recombinant B. sphaericus strains. Total DNA from strains 2297 bin :: cry11A pro :: cry11Ba (lanes 1); 2297 (lanes 2); 2297 pro :: cry11Ba (lanes A3 and B3); 2297 pro :: cry11A (lanes A4 and D3); and 2297 pro :: aphA3 (lane A5). DNA was digested with Eco RI and subjected to electrophoresis in a 0.7% agarose gel. DNA fragments were transferred onto Hybond N + membranes and hybridized with [α- 32 P]dATP-labeled probes corresponding to the 5′ end of the protease gene (A), the internal part of cry11Ba (B), the 5′ end of the binary toxin operon (C), and the 5′ end of cry11A (D). The size of the reactive fragments was as expected. In part C, the existence of two copies of the binary toxin in strain 2297 led to the presence of the three bands observed in lane 1.

Techniques Used: Southern Blot, Recombinant, Electrophoresis, Agarose Gel Electrophoresis, Labeling

Related Articles

Amplification:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: The primers used for the amplification of the pfbp gene were 5′-CTGTCGCTTATGAATGTG-3′ and 5′-CGCGAATTCACTCTTTGGCTTATCTTTTTTAGG-3′ and for P235 were 5′-GGAAACAAGAAATGGAGCAAA-3′ and 5′-TCCGGCTGGTTTTATCATA-3′ (forward and reverse primers, respectively, in each case). .. The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: The primers used for the prtF1 -like amplification were 5′-ATGTTTGTGAGAGGAGAGAA-3′ (designed for this study) and 5′-CAATATCTCCTGTTGCAGGAAG-3′ ( ) as the forward and reverse primers, respectively. .. For both Northern assays the probes were labeled with [α-32 P]dATP (Amersham) as described for the Southern assay.

Autoradiography:

Article Title: DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells
Article Snippet: The probe was labelled by random priming (Rediprime II, Amersham) with [α–32 P]dATP (Amersham). .. Blots were washed twice with 2× SSC–0.1% SDS at room temperature, twice with 1× SSC–0.1% SDS and twice with 0.1× SSC–0.1% SDS at 65°C, prior to autoradiography.

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham). .. Hybridizations were performed under stringent conditions and revealed by autoradiography with X-Omat AR films (Eastman Kodak Co., Rochester, N.Y.) in the presence of intensifying screens.

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: .. Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Band intensities were analyzed using NIH Image software.

Electrophoresis:

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE
Article Snippet: To produce porin-specific gene probes, DNA fragments (a 900-bp Hin cII- Bgl II ompF fragment from pMY222, a 554-bp Eco RI- Eco RV ompC fragment from pMY150, and a 834-bp Pst I- Bgl II phoE fragment from pJP29) were radioactively labeled with [α-32 P]dATP (Amersham), using a Random Primer DNA labeling kit (Bio-Rad). .. For Southern blot analysis, performed as described by the manufacturer (Amersham), chromosomal DNAs of E. coli K-12 CE1249, BE BL21(DE3), and BE BZB1107 were digested with restriction endonuclease Eco RV and fractionated by electrophoresis on 0.8% agarose gels.

Incubation:

Article Title: The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region
Article Snippet: These oligonucleotides were labeled with α[32 P]-dATP and the Klenow fragment of DNA polymerase I (Amersham Pharmacia), by standard methods, according to the manufacturer's recommendations. .. Radiolabeled probe (∼2,000 cpm) and 1 μg of HeLa-cell nuclear extract (NE) (Santa Cruz Biotechnology) were incubated for ∼20 min in 20 μl reaction buffer (Bandshift Kit; Amersham Pharmacia).

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. Samples (3 µl) of the labeled DNA fragments were incubated with 5 µl of the buffered solution containing the ligand at appropriate concentration.

Article Title: Unphosphorylatable mutants of Cdc6 disrupt its nuclear export but still support DNA replication once per cell cycle
Article Snippet: Replication was detected by incorporation of biotin-16-dUTP (20 μM, Roche) or [α-32 P]dATP (100 μCi/mL, Amersham). .. For density substitution experiments, reactions were incubated in the presence of 0.25 mM BrdUTP and 100 μCi/mL [α-32 P]dATP and were processed as in .

Article Title: Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2
Article Snippet: The Eco RI- Sph I or Hin dIII- Kpn I DNA fragments obtained from pUO183 were end labeled at the Eco RI or Hin dIII sites with Klenow DNA polymerase and [α-32 P]dATP (3,000 Ci/mmol; Amersham). .. End-labeled DNA (81 pM) was incubated for 30 min at 30°C in the absence or presence of CI and/or B. subtilis ςA -RNAP in 20 μl of buffer B plus poly(dI)-poly(dC) as an unspecific competitor (at a final concentration of 50 ng/μl), followed by the addition of freshly diluted DNase I (Boehringer Mannheim) (at a concentration to obtain, on average, one cut per molecule).

Expressing:

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Expression of human eNOS was normalized using 28s rRNA.

Derivative Assay:

Article Title: DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells
Article Snippet: RNA blots containing 2 μg of poly(A)+ RNA per lane of different human tissues (MTN and MTN–II blots, Clontech) were hybridized with a probe (derived from EST ) containing 1141 nucleotides corresponding to the 3′ end of Pol μ cDNA. .. The probe was labelled by random priming (Rediprime II, Amersham) with [α–32 P]dATP (Amersham).

Hybridization:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: Paragraph title: Southern hybridization. ... The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Southern Blot:

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE
Article Snippet: Paragraph title: Standard DNA preparations, DNA labeling, and Southern blot analysis. ... To produce porin-specific gene probes, DNA fragments (a 900-bp Hin cII- Bgl II ompF fragment from pMY222, a 554-bp Eco RI- Eco RV ompC fragment from pMY150, and a 834-bp Pst I- Bgl II phoE fragment from pJP29) were radioactively labeled with [α-32 P]dATP (Amersham), using a Random Primer DNA labeling kit (Bio-Rad).

Footprinting:

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: Paragraph title: DNase I footprinting ... The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche).

Article Title: Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2
Article Snippet: Paragraph title: DNase I footprinting. ... The Eco RI- Sph I or Hin dIII- Kpn I DNA fragments obtained from pUO183 were end labeled at the Eco RI or Hin dIII sites with Klenow DNA polymerase and [α-32 P]dATP (3,000 Ci/mmol; Amersham).

Northern Blot:

Article Title: DNA polymerase mu (Pol ?), homologous to TdT, could act as a DNA mutator in eukaryotic cells
Article Snippet: Paragraph title: Northern blotting ... The probe was labelled by random priming (Rediprime II, Amersham) with [α–32 P]dATP (Amersham).

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: .. For both Northern assays the probes were labeled with [α-32 P]dATP (Amersham) as described for the Southern assay. .. Standard hybridization protocols were followed.

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: Paragraph title: Northern blotting ... Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography.

DNA Labeling:

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE
Article Snippet: Paragraph title: Standard DNA preparations, DNA labeling, and Southern blot analysis. ... To produce porin-specific gene probes, DNA fragments (a 900-bp Hin cII- Bgl II ompF fragment from pMY222, a 554-bp Eco RI- Eco RV ompC fragment from pMY150, and a 834-bp Pst I- Bgl II phoE fragment from pJP29) were radioactively labeled with [α-32 P]dATP (Amersham), using a Random Primer DNA labeling kit (Bio-Rad).

Polymerase Chain Reaction:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: Two different probes were used for this assay, the PCR-amplified pfbp gene and a PCR fragment of 235 bp (P235) corresponding to the first 78 amino acids of the mature protein. .. The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: Similarly, for the M6 strain assay, the extraction was done after 5 h (mid-log phase) of growth at 37°C, and the PCR-amplified prtF1 gene was used as a probe for the hybridization. .. For both Northern assays the probes were labeled with [α-32 P]dATP (Amersham) as described for the Southern assay.

Nucleic Acid Electrophoresis:

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. The labeled DNA was purified by gel electrophoresis and resuspended in 10 mM Tris pH 7.0, containing 10 mM NaCl.

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: The RNAs (10 μg) were separated by formaldehyde-agarose gel electrophoresis and transferred to a nylon (+) membrane (MSI, Westboro, Mass.) by using the Turboblotter system (Schleicher & Schuell, Inc., Keene, N.H.). .. For both Northern assays the probes were labeled with [α-32 P]dATP (Amersham) as described for the Southern assay.

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: .. Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Band intensities were analyzed using NIH Image software.

Electrophoretic Mobility Shift Assay:

Article Title: The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region
Article Snippet: Paragraph title: Electrophoretic-Mobility–Shift Assays (EMSAs) ... These oligonucleotides were labeled with α[32 P]-dATP and the Klenow fragment of DNA polymerase I (Amersham Pharmacia), by standard methods, according to the manufacturer's recommendations.

Purification:

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. The labeled DNA was purified by gel electrophoresis and resuspended in 10 mM Tris pH 7.0, containing 10 mM NaCl.

Article Title: Functional characterization of highly processive protein-primed DNA polymerases from phages Nf and GA-1, endowed with a potent strand displacement capacity
Article Snippet: Nucleotides and DNAs Unlabelled nucleotides, as well as [α-32 P]dATP [3000 Ci/mmol (1 Ci = 37 GBq)] and [γ-32 P]ATP (3000 Ci/mmol) were obtained from Amersham Pharmacia. .. Oligonucleotides sp1 and sp1p were 5′-labelled with [γ-32 P]ATP and phage T4 polynucleotide kinase and purified electrophoretically on 8 M urea–20% polyacrylamide gels.

Random Primer DNA Labeling:

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE
Article Snippet: .. To produce porin-specific gene probes, DNA fragments (a 900-bp Hin cII- Bgl II ompF fragment from pMY222, a 554-bp Eco RI- Eco RV ompC fragment from pMY150, and a 834-bp Pst I- Bgl II phoE fragment from pJP29) were radioactively labeled with [α-32 P]dATP (Amersham), using a Random Primer DNA labeling kit (Bio-Rad). .. For Southern blot analysis, performed as described by the manufacturer (Amersham), chromosomal DNAs of E. coli K-12 CE1249, BE BL21(DE3), and BE BZB1107 were digested with restriction endonuclease Eco RV and fractionated by electrophoresis on 0.8% agarose gels.

Labeling:

Article Title: The Promoter of a Lysosomal Membrane Transporter Gene, CTNS, Binds Sp-1, Shares Sequences with the Promoter of an Adjacent Gene, CARKL, and Causes Cystinosis If Mutated in a Critical Region
Article Snippet: .. These oligonucleotides were labeled with α[32 P]-dATP and the Klenow fragment of DNA polymerase I (Amersham Pharmacia), by standard methods, according to the manufacturer's recommendations. .. Radiolabeled probe (∼2,000 cpm) and 1 μg of HeLa-cell nuclear extract (NE) (Santa Cruz Biotechnology) were incubated for ∼20 min in 20 μl reaction buffer (Bandshift Kit; Amersham Pharmacia).

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. The labeled DNA was purified by gel electrophoresis and resuspended in 10 mM Tris pH 7.0, containing 10 mM NaCl.

Article Title: Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a
Article Snippet: .. Three mixtures of labeling nucleotides were made, containing 1 vol of [α-33 P]dGTP (≈2000 Ci/mmol, 10 μCi/μl; DuPont) with 1 vol of [α-32 P]dATP, [α-32 P]dTTP, or [α-32 P]dCTP (each 3000 Ci/mmol, 10 μCi/μl; Amersham Pharmacia). ..

Article Title: Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 Replication and Transcription Activator Regulates Viral and Cellular Genes via Interferon-Stimulated Response Elements
Article Snippet: .. The probes were obtained by first annealing complementary oligonucleotides and then labeling them with [α-32 P]dATP (Amersham) using DNA polymerase Klenow fragment (Fermentas). .. The K14 ISRE probe was obtained by annealing two oligonucleotides, 5′-ACAGGTACCGTGAGAAACAGAAACGGC-3′ and its complementary strand, with ACAGGTACC at the 5′ end.

Article Title: Identification and Characterization of Two Quiescent Porin Genes, nmpC and ompN, in Escherichia coli BE
Article Snippet: .. To produce porin-specific gene probes, DNA fragments (a 900-bp Hin cII- Bgl II ompF fragment from pMY222, a 554-bp Eco RI- Eco RV ompC fragment from pMY150, and a 834-bp Pst I- Bgl II phoE fragment from pJP29) were radioactively labeled with [α-32 P]dATP (Amersham), using a Random Primer DNA labeling kit (Bio-Rad). .. For Southern blot analysis, performed as described by the manufacturer (Amersham), chromosomal DNAs of E. coli K-12 CE1249, BE BL21(DE3), and BE BZB1107 were digested with restriction endonuclease Eco RV and fractionated by electrophoresis on 0.8% agarose gels.

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: .. For both Northern assays the probes were labeled with [α-32 P]dATP (Amersham) as described for the Southern assay. .. Standard hybridization protocols were followed.

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: .. Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Band intensities were analyzed using NIH Image software.

Article Title: Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2
Article Snippet: .. The Eco RI- Sph I or Hin dIII- Kpn I DNA fragments obtained from pUO183 were end labeled at the Eco RI or Hin dIII sites with Klenow DNA polymerase and [α-32 P]dATP (3,000 Ci/mmol; Amersham). .. End-labeled DNA (81 pM) was incubated for 30 min at 30°C in the absence or presence of CI and/or B. subtilis ςA -RNAP in 20 μl of buffer B plus poly(dI)-poly(dC) as an unspecific competitor (at a final concentration of 50 ng/μl), followed by the addition of freshly diluted DNase I (Boehringer Mannheim) (at a concentration to obtain, on average, one cut per molecule).

Staining:

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: .. Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Band intensities were analyzed using NIH Image software.

Plasmid Preparation:

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: .. The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. The labeled DNA was purified by gel electrophoresis and resuspended in 10 mM Tris pH 7.0, containing 10 mM NaCl.

Software:

Article Title: Alternative polyadenylation sites of human endothelial nitric oxide synthase mRNA
Article Snippet: Total RNA from normal human tissues (Clontech) (20 μg/lane) was subjected to formaldehyde–agarose gel electrophoresis, stained with ethidium bromide, transferred to a Hybond-N+ membrane (Amersham Biosciencs, Piscataway, NJ, USA), and hybridized with oligonucleotide probes (239R: 5′-ATCTAACATTCGACTAAGAAACAGGAAGCGGGTGGCAGTAGGCCCTGGGG-3′and 511R: 5′-GGCTGAGGCAGGAGAATCACTTGAACTTGTGGGGTGGAGGTTGCAGTGA G-3′) labeled with [α-32 P]dATP (Amersham Biosciencs) at the 3′-end and detected by autoradiography. .. Band intensities were analyzed using NIH Image software.

Agarose Gel Electrophoresis:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: The DNAs were subsequently digested with Eco RI, separated by agarose gel electrophoresis, and then transferred to Hybond-N or Hybond-N(+) membranes (Amersham). .. The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Concentration Assay:

Article Title: DNA sequence recognition by the indolocarbazole antitumor antibiotic AT2433-B1 and its diastereoisomer
Article Snippet: The 117 bp DNA fragment was prepared by 3′-32 P-end-labeling of an Eco RI + Pvu II double digest of plasmid pBS (Stratagene) using [α-32 P]dATP (3000 Ci mmol–1 ; Amersham) and AMV reverse transcriptase (Roche). .. Samples (3 µl) of the labeled DNA fragments were incubated with 5 µl of the buffered solution containing the ligand at appropriate concentration.

Article Title: Cooperative Interaction of CI Protein Regulates Lysogeny of Lactobacillus casei by Bacteriophage A2
Article Snippet: The Eco RI- Sph I or Hin dIII- Kpn I DNA fragments obtained from pUO183 were end labeled at the Eco RI or Hin dIII sites with Klenow DNA polymerase and [α-32 P]dATP (3,000 Ci/mmol; Amersham). .. End-labeled DNA (81 pM) was incubated for 30 min at 30°C in the absence or presence of CI and/or B. subtilis ςA -RNAP in 20 μl of buffer B plus poly(dI)-poly(dC) as an unspecific competitor (at a final concentration of 50 ng/μl), followed by the addition of freshly diluted DNase I (Boehringer Mannheim) (at a concentration to obtain, on average, one cut per molecule).

DNA Purification:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: DNA from different M-type strains [M6(D471), M5(1RP144), M14(4RP106), M1(D710), M12(A735), M2(D444), M13(D742), M28R(T28/150A), M58(A774), and M62(A956)] from the Rockefeller University collection was extracted as follows: a phage lysin treatment of the streptococci, in order to generate protoplasts, was performed as described before , followed by lysis of the protoplasts and genomic DNA purification by standard protocols ( ). .. The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Lysis:

Article Title: Identification and Characterization of a Novel Fibronectin-Binding Protein on the Surface of Group A Streptococci
Article Snippet: DNA from different M-type strains [M6(D471), M5(1RP144), M14(4RP106), M1(D710), M12(A735), M2(D444), M13(D742), M28R(T28/150A), M58(A774), and M62(A956)] from the Rockefeller University collection was extracted as follows: a phage lysin treatment of the streptococci, in order to generate protoplasts, was performed as described before , followed by lysis of the protoplasts and genomic DNA purification by standard protocols ( ). .. The probe corresponding to the whole gene was labeled with [α-32 P]dATP (Amersham) by random labeling (Ready-to-Go; Pharmacia, Uppsala, Sweden), and the P235 was labeled by enhanced chemiluminescence direct nucleic acid labeling (Amersham).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    GE Healthcare megaprime dna labeling system
    Megaprime Dna Labeling System, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megaprime dna labeling system/product/GE Healthcare
    Average 93 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    megaprime dna labeling system - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    90
    GE Healthcare α 32 p datp
    α 32 P Datp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p datp/product/GE Healthcare
    Average 90 stars, based on 213 article reviews
    Price from $9.99 to $1999.99
    α 32 p datp - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results