Review



runx2 s-19  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology runx2 s-19
    TABLE 1
    Runx2 S 19, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/anti+runx2/pmc04653688-150-17-20
    Average 90 stars, based on 1 article reviews
    runx2 s-19 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "Epigenetic Control of the Bone-master Runx2 Gene during Osteoblast-lineage Commitment by the Histone Demethylase JARID1B/KDM5B * "

    Article Title: Epigenetic Control of the Bone-master Runx2 Gene during Osteoblast-lineage Commitment by the Histone Demethylase JARID1B/KDM5B *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.657825

    TABLE 1
    Figure Legend Snippet: TABLE 1

    Techniques Used: Expressing

    Related Articles

    other:

    Article Title: Target analysis and identification of curcumin against vascular calcification
    Article Snippet: These primary antibodies were prepared in this study: anti-BMP2, anti- RUNX2, anti-GAPDH, anti-BCL2, anti-Bax, anti-AKT, anti-p65, anti-STAT3 and anti-EGFR purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

    Article Title: RBFOX2 induces osteogenic differentiation by Jph2 expression in MC3T3-E1 preosteoblast cells.
    Article Snippet: Background RNA binding Fox-1 homolog 2 (RBFOX2) is an RNA-binding protein that has been extensively studied in heart disease.. Its downstream target, Jph2, has also been primarily investigated in relation to heart disease.. However, their roles in osteoblast differentiation remain unexplored.

    Article Title: Fine-tuning of Wnt signaling by RNA surveillance factor Smg5 in the mouse craniofacial development
    Article Snippet: Jo urn al Pr e-p roo f Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Smg5 Abcam Cat# ab33033; RRID: AB_882612 Sox9 Abcam Cat# ab185230; RRID: AB_2715497 Runx2 Santa Cruz Biotechnology Cat# sc-390351; RRID: AB_2892645 Sp7 Abcam Cat# ab209484; RRID: AB_2892207 Porcn Abcam Cat# ab105543; RRID: AB_10860951 p-JNK Cell Signaling Technology Cat#4668; RRID: AB_823588 JNK Cell Signaling Technology Cat# A4867; RRID: AB_2863367 β-Actin Cell Signaling Technology Cat#3700; RRID: AB_2242334 Critical commercial assays TUNEL BrightGreen apoptosis detection kit Vazyme Cat#A112 RevertAidTM Master Mix ThermoFischer Scientific Cat# M1632 UltraSYBR mixture CWBIO Cat#E606335 Trizol ThermoFischer Scientific Cat# 15596026CN 2xTaq MasterMix CWBIO Cat#CW0690 SsoFast EvaGreen Super mix Bio-Rad Cat#1725204 Recombinant Wnt5a R&D Cat#645-WN; P22725 Deposited data RNA-Seq data of developing embryos This paper CRA009091 Experimental models: Organisms/strains Mouse: Smg5Flox/Flox Dr. Li Chen et al.38 Mouse: Wnt1-Cre The Jackson Laboratory Cat#004782 Mouse: ROSAmT/mG The Jackson Laboratory Cat#007676 Oligonucleotides Genotyping primer for Smg5: Forward: CAGGACTATGAACTGACATGGAGG This paper N/A Genotyping primer for Smg5: Reverse: TACCTCTTAGGGAAAGCTGGGCC This paper N/A Genotyping primer for Cre: Forward: TTCTGCGGGAAACCATTTCCG This paper N/A Genotyping primer for Cre: Reverse: ACTCGCATCACTGCCCTCA This paper N/A RT-PCR primer for Porcn: Forward: CTCCATCTGTCCATCCATCTGT This paper N/A RT-PCR primer for Porcn: Reverse: GCTCCACATTCAACGGTCTA This paper N/A QPCR and RT-PCR primers for NMD targets Weischenfeldt et al.20,40 N/A Software and algorithms GraphPad Prism 9.5 Graphpad Software http://www.graphpad.com/ Photoshop Photoshop Software https://www.adobe.com Jo urn al Pr e-p roo f Image Lab 5.1 Image Lab Software Bio-Rad Jo urn al Pr e-p roo f


    Article Title: Modularity-based mathematical modeling of ligand inter-nanocluster connectivity for unraveling reversible stem cell regulation.
    Article Snippet: The proteins of interest in the adherent cells, RUNX2 (Santa Cruz, sc101145, 60 kDa) and ALP (Abcam, ab67228, 75 kDa), were extracted via centrifugation using PRO-PREPTM solution (iNtRON Biotechnology) and a protease-inhibitor.

    Cell Culture:

    Article Title: Hybrid Micro-/Nanoprotein Platform Provides Endocrine-like and Extracellular Matrix-like Cell Delivery of Growth Factors.
    Article Snippet: .. Cells were cultured for 14 days and fixed on protein-FN-PEAfunctionalized 24 well plates, permeabilized, and blocked following previously reported procedures.33 Cells were incubated with monoclonal primary Abs (1:200) in blocking buffer (PBS/1% milk protein) at room temperature for 2.5 h, respectively; Runx2 (Santa Cruz Biotechnology, C1319), osteonectin (Santa Cruz Biotechnology, SC398419), and osteopontin (Santa Cruz Biotechnology, B1218). .. Cells were then repeatedly washed for 10 min (PBS/0.1% Tween 20) and incubated with an infrared-labeled secondary Ab IRDye 800CW (1:800; LI-COR) + CellTag 700 Stain (1:500; LI-COR) + PBS/0.2% Tween 20 mixture at room temperature for 1 h while being shielded from light.

    Incubation:

    Article Title: Hybrid Micro-/Nanoprotein Platform Provides Endocrine-like and Extracellular Matrix-like Cell Delivery of Growth Factors.
    Article Snippet: .. Cells were cultured for 14 days and fixed on protein-FN-PEAfunctionalized 24 well plates, permeabilized, and blocked following previously reported procedures.33 Cells were incubated with monoclonal primary Abs (1:200) in blocking buffer (PBS/1% milk protein) at room temperature for 2.5 h, respectively; Runx2 (Santa Cruz Biotechnology, C1319), osteonectin (Santa Cruz Biotechnology, SC398419), and osteopontin (Santa Cruz Biotechnology, B1218). .. Cells were then repeatedly washed for 10 min (PBS/0.1% Tween 20) and incubated with an infrared-labeled secondary Ab IRDye 800CW (1:800; LI-COR) + CellTag 700 Stain (1:500; LI-COR) + PBS/0.2% Tween 20 mixture at room temperature for 1 h while being shielded from light.

    Blocking Assay:

    Article Title: Hybrid Micro-/Nanoprotein Platform Provides Endocrine-like and Extracellular Matrix-like Cell Delivery of Growth Factors.
    Article Snippet: .. Cells were cultured for 14 days and fixed on protein-FN-PEAfunctionalized 24 well plates, permeabilized, and blocked following previously reported procedures.33 Cells were incubated with monoclonal primary Abs (1:200) in blocking buffer (PBS/1% milk protein) at room temperature for 2.5 h, respectively; Runx2 (Santa Cruz Biotechnology, C1319), osteonectin (Santa Cruz Biotechnology, SC398419), and osteopontin (Santa Cruz Biotechnology, B1218). .. Cells were then repeatedly washed for 10 min (PBS/0.1% Tween 20) and incubated with an infrared-labeled secondary Ab IRDye 800CW (1:800; LI-COR) + CellTag 700 Stain (1:500; LI-COR) + PBS/0.2% Tween 20 mixture at room temperature for 1 h while being shielded from light.



    Similar Products

    runx2 s 19  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology runx2 s 19
    Runx2 S 19, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/RUNX2+Antibody/pmc07261149-55-27-30
    Average 96 stars, based on 1 article reviews
    runx2 s 19 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    runx2 s-19 sc-12488 antibody  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology runx2 s-19 sc-12488 antibody
    TABLE 1
    Runx2 S 19 Sc 12488 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/anti+runx2/pmc04653688-74-17-20
    Average 90 stars, based on 1 article reviews
    runx2 s-19 sc-12488 antibody - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    runx2 s-19  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology runx2 s-19
    TABLE 1
    Runx2 S 19, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/anti+runx2/pmc04653688-150-17-20
    Average 90 stars, based on 1 article reviews
    runx2 s-19 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rabbit or goat anti-runx2 antibody m-70 or s-19  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology rabbit or goat anti-runx2 antibody m-70 or s-19
    TABLE 1
    Rabbit Or Goat Anti Runx2 Antibody M 70 Or S 19, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/anti+runx2/10__1074_slash_jbc__m114__570507-80-7-17
    Average 90 stars, based on 1 article reviews
    rabbit or goat anti-runx2 antibody m-70 or s-19 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    peb2αa/runx2 s-19 sc12488 antibody  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology peb2αa/runx2 s-19 sc12488 antibody
    TABLE 1
    Peb2αa/Runx2 S 19 Sc12488 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/anti+runx2/us08415316-297-10-23
    Average 90 stars, based on 1 article reviews
    peb2αa/runx2 s-19 sc12488 antibody - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    anti runx2 s 19 primary antibodies  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology anti runx2 s 19 primary antibodies
    Oligodeoxynucleotide primers used for qRT-PCR.
    Anti Runx2 S 19 Primary Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/runx2+s+19/RUNX2+Antibody/pmc03720872-54-16-23
    Average 96 stars, based on 1 article reviews
    anti runx2 s 19 primary antibodies - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    TABLE 1

    Journal: The Journal of Biological Chemistry

    Article Title: Epigenetic Control of the Bone-master Runx2 Gene during Osteoblast-lineage Commitment by the Histone Demethylase JARID1B/KDM5B *

    doi: 10.1074/jbc.M115.657825

    Figure Lengend Snippet: TABLE 1

    Article Snippet: Primaryantibodies used were the following: αTFIIB C-18 (sc-225, Santa Cruz Biotechnology), RNA-PolII N-20 (sc-899, Santa Cruz Biotechnology), Runx2 S-19 (sc-12488, Santa Cruz Biotechnology), WDR5 (ab56919, Abcam), NO66 3354c5a (sc-81341, Santa Cruz Biotechnology), JARID1B (ab50958, Abcam), EZH2 (39901, Active Motif), UTX/KDM6A (ab91231, Abcam), PRMT5/JBP1 (611539, BD Biosciences), P300 N-15 (sc-584, Santa Cruz Biotechnology).

    Techniques: Expressing, Knockdown

    TABLE 1

    Journal: The Journal of Biological Chemistry

    Article Title: Epigenetic Control of the Bone-master Runx2 Gene during Osteoblast-lineage Commitment by the Histone Demethylase JARID1B/KDM5B *

    doi: 10.1074/jbc.M115.657825

    Figure Lengend Snippet: TABLE 1

    Article Snippet: Primaryantibodies used were the following: αTFIIB C-18 (sc-225, Santa Cruz Biotechnology), RNA-PolII N-20 (sc-899, Santa Cruz Biotechnology), Runx2 S-19 (sc-12488, Santa Cruz Biotechnology), WDR5 (ab56919, Abcam), NO66 3354c5a (sc-81341, Santa Cruz Biotechnology), JARID1B (ab50958, Abcam), EZH2 (39901, Active Motif), UTX/KDM6A (ab91231, Abcam), PRMT5/JBP1 (611539, BD Biosciences), P300 N-15 (sc-584, Santa Cruz Biotechnology).

    Techniques: Expressing

    Oligodeoxynucleotide primers used for qRT-PCR.

    Journal: PLoS ONE

    Article Title: Low-Intensity Pulsed Ultrasound Accelerates Tooth Movement via Activation of the BMP-2 Signaling Pathway

    doi: 10.1371/journal.pone.0068926

    Figure Lengend Snippet: Oligodeoxynucleotide primers used for qRT-PCR.

    Article Snippet: Primary α-tubulin antibody was purchased from Millipore (MAB5566, Billerica, MA, USA); anti-β-actin (N-21), anti-HGF (H-170), and anti-Runx2 (S-19) primary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques:

    (A). hPDL cells were cultured in the presence and absence of daily LIPUS stimulation. BMP-2 mRNA expression was determined using qRT-PCR. (B). BMP-2 protein (ROW 1; 45 kDa) can be detected in the control and LIPUS groups (1: CON; 2: LIPUS). The LIPUS groups showed higher expression of BMP-2 from day 5. (C). Quantification of BMP-2 protein expression in the LIPUS stimulation group was greater than that in the control group on days 5, 7, and 14. *indicates P<0.05 . (D–F). Rat upper first molars were stimulated with or without LIPUS for different time intervals, and HGF, Runx2, BMP-2 were determined by qRT-PCR and Western blot, respectively. The data indicated that LIPUS increased HGF, Runx2, and BMP-2 mRNA (D: LIPUS stimulation 0 day vs LIPUS stimulation 3 day, P<0.05; 0 day vs 7 day, P<0.01 ) and protein expression (E, F: LIPUS stimulation 0 day vs LIPUS stimulation 3 day, P<0.05; 0 day vs 7 day, P<0.01 ) in vivo . The data are the mean ± SD of three separate experiments.

    Journal: PLoS ONE

    Article Title: Low-Intensity Pulsed Ultrasound Accelerates Tooth Movement via Activation of the BMP-2 Signaling Pathway

    doi: 10.1371/journal.pone.0068926

    Figure Lengend Snippet: (A). hPDL cells were cultured in the presence and absence of daily LIPUS stimulation. BMP-2 mRNA expression was determined using qRT-PCR. (B). BMP-2 protein (ROW 1; 45 kDa) can be detected in the control and LIPUS groups (1: CON; 2: LIPUS). The LIPUS groups showed higher expression of BMP-2 from day 5. (C). Quantification of BMP-2 protein expression in the LIPUS stimulation group was greater than that in the control group on days 5, 7, and 14. *indicates P<0.05 . (D–F). Rat upper first molars were stimulated with or without LIPUS for different time intervals, and HGF, Runx2, BMP-2 were determined by qRT-PCR and Western blot, respectively. The data indicated that LIPUS increased HGF, Runx2, and BMP-2 mRNA (D: LIPUS stimulation 0 day vs LIPUS stimulation 3 day, P<0.05; 0 day vs 7 day, P<0.01 ) and protein expression (E, F: LIPUS stimulation 0 day vs LIPUS stimulation 3 day, P<0.05; 0 day vs 7 day, P<0.01 ) in vivo . The data are the mean ± SD of three separate experiments.

    Article Snippet: Primary α-tubulin antibody was purchased from Millipore (MAB5566, Billerica, MA, USA); anti-β-actin (N-21), anti-HGF (H-170), and anti-Runx2 (S-19) primary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Cell Culture, Expressing, Quantitative RT-PCR, Control, Western Blot, In Vivo

    (A). hPDL cells were incubated with HGF for 24 h, and BMP-2 mRNA was examined by qRT-PCR. (B and C) hPDL cells were incubated with HGF for 48 h, and BMP-2 protein amounts were detected by Western blotting. The data shows that HGF significantly increased BMP-2 expression. (D). Cells were transfected with Runx2 siRNA for 24 h followed by stimulation with LIPUS for 5 days, and BMP-2 mRNA expression was examined by qRT-PCR. (E and F) hPDL cells were transfected with Runx2 siRNA for 5 days, and BMP-2 protein expression was examined by Western blot. Transfection of cells with Runx2 siRNA reduced LIPUS-increased BMP-2 expression. * P<0.05 (** P<0.01 ) as compared with the control group.

    Journal: PLoS ONE

    Article Title: Low-Intensity Pulsed Ultrasound Accelerates Tooth Movement via Activation of the BMP-2 Signaling Pathway

    doi: 10.1371/journal.pone.0068926

    Figure Lengend Snippet: (A). hPDL cells were incubated with HGF for 24 h, and BMP-2 mRNA was examined by qRT-PCR. (B and C) hPDL cells were incubated with HGF for 48 h, and BMP-2 protein amounts were detected by Western blotting. The data shows that HGF significantly increased BMP-2 expression. (D). Cells were transfected with Runx2 siRNA for 24 h followed by stimulation with LIPUS for 5 days, and BMP-2 mRNA expression was examined by qRT-PCR. (E and F) hPDL cells were transfected with Runx2 siRNA for 5 days, and BMP-2 protein expression was examined by Western blot. Transfection of cells with Runx2 siRNA reduced LIPUS-increased BMP-2 expression. * P<0.05 (** P<0.01 ) as compared with the control group.

    Article Snippet: Primary α-tubulin antibody was purchased from Millipore (MAB5566, Billerica, MA, USA); anti-β-actin (N-21), anti-HGF (H-170), and anti-Runx2 (S-19) primary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Incubation, Quantitative RT-PCR, Western Blot, Expressing, Transfection, Control