Review





Similar Products

86
Sangon Biotech si rna forward 5 ccaaugucuggugacuuutt 3 and reverse 5 aaagucaccagacauuuggtt 3
Si Rna Forward 5 Ccaaugucuggugacuuutt 3 And Reverse 5 Aaagucaccagacauuuggtt 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/for+rna+si+ythdc2+ythdc2/pmc12987553-52-3-27
Average 86 stars, based on 1 article reviews
si rna forward 5 ccaaugucuggugacuuutt 3 and reverse 5 aaagucaccagacauuuggtt 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

95
New England Biolabs anti reverse cap analog
Anti Reverse Cap Analog, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/3OMem7G+(5)ppp+(5)G+RNACapStrucAnalog/pm41997928-225-15-29
Average 95 stars, based on 1 article reviews
anti reverse cap analog - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
YMC America semi preparative reverse phase column ymc triart c18 150 25 mm 5 um mobile phase
Semi Preparative Reverse Phase Column Ymc Triart C18 150 25 Mm 5 Um Mobile Phase, supplied by YMC America, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/YMC-Triart+C18/us12589156-611-5-9
Average 99 stars, based on 1 article reviews
semi preparative reverse phase column ymc triart c18 150 25 mm 5 um mobile phase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Sangon Biotech usp1 forward 5 cagctggacctggagaaacg 3 reverse 5 tccaggtaggcatccacatc 3
MCM3 is overexpressed in HCC and is closely related to <t>USP1</t> (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Usp1 Forward 5 Cagctggacctggagaaacg 3 Reverse 5 Tccaggtaggcatccacatc 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc12961299-102-0-6
Average 86 stars, based on 1 article reviews
usp1 forward 5 cagctggacctggagaaacg 3 reverse 5 tccaggtaggcatccacatc 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Twist Bioscience reverse primer 5 tccctcatcgacgccagagtag
MCM3 is overexpressed in HCC and is closely related to <t>USP1</t> (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Reverse Primer 5 Tccctcatcgacgccagagtag, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/3+5+primer+reverse+tccctcatcgacgccagagtag/pm41862633-284-12-6
Average 86 stars, based on 1 article reviews
reverse primer 5 tccctcatcgacgccagagtag - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech mcm3 forward 5 tcagagagattacctg gacttcc 3 reverse 5 tcagccggtattggttgtcac 3
<t>MCM3</t> is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Mcm3 Forward 5 Tcagagagattacctg Gacttcc 3 Reverse 5 Tcagccggtattggttgtcac 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc12961299-101-0-7
Average 86 stars, based on 1 article reviews
mcm3 forward 5 tcagagagattacctg gacttcc 3 reverse 5 tcagccggtattggttgtcac 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Azenta primer reverse dna 187 5 ggtcgctgttcaatacatgctatcgat 3
<t>MCM3</t> is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Primer Reverse Dna 187 5 Ggtcgctgttcaatacatgctatcgat 3, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/forward+primer/pmc12955571-52-0-7
Average 86 stars, based on 1 article reviews
primer reverse dna 187 5 ggtcgctgttcaatacatgctatcgat 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Azenta primer reverse dna 147 5 tatcgatgtatatatctgac 3
<t>MCM3</t> is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Primer Reverse Dna 147 5 Tatcgatgtatatatctgac 3, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/forward+primer/pmc12955571-50-0-7
Average 86 stars, based on 1 article reviews
primer reverse dna 147 5 tatcgatgtatatatctgac 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech β actin forward 5 catgtacgttgctatccaggc 3 reverse 5 ctccttaatgtcacgcacgat 3
<t>MCM3</t> is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
β Actin Forward 5 Catgtacgttgctatccaggc 3 Reverse 5 Ctccttaatgtcacgcacgat 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/aagccagcgaggtaggaaggtag+cacttgtgttgctgcctctcctc+forward+primers+reverse+wdr77/pmc12961299-100-0-6
Average 86 stars, based on 1 article reviews
β actin forward 5 catgtacgttgctatccaggc 3 reverse 5 ctccttaatgtcacgcacgat 3 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

95
New England Biolabs anti reverse cap analog arca
<t>MCM3</t> is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.
Anti Reverse Cap Analog Arca, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+5/3OMem7G+(5)ppp+(5)G+RNACapStrucAnalog/10__3390_slash_mi17030359-103-32-38
Average 95 stars, based on 1 article reviews
anti reverse cap analog arca - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

Image Search Results


MCM3 is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.

Article Snippet: USP1 Forward 5′-CAGCTGGACCTGGAGAAACG-3′ Reverse 5′-TCCAGGTAGGCATCCACATC-3′ , Sangon Biotech , N/A.

Techniques: Diagnostic Assay, Marker, Expressing, Staining

USP1 influences HCC proliferation and combined with MCM3 (A and B) RT-qPCR and WB were used to confirm the efficiency of USP1 overexpression in Huh7 and LM3 cells. (C) WB analysis to detect the impact of USP1 overexpression on MCM3 in Huh7 and LM3 cells. (D) Co-IP assay to confirm the interaction between MCM3 and USP1 ( n = 3 biologically independent experiments). (E and F) RT-qPCR and WB analysis to verify the knockdown efficiency of USP1 . (G) EdU staining to assess the impact of USP1 knockdown on DNA replication in Huh7 and LM3 cells. (H) Transwell assay to evaluate the impact of USP1 knockdown on the invasion ability of Huh7 and LM3 cells (×100). Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05. For (A–C), (G), and (H), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments); For (E) and (F), statistical analysis was performed using a one-way analysis of variance (ANOVA) ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: USP1 influences HCC proliferation and combined with MCM3 (A and B) RT-qPCR and WB were used to confirm the efficiency of USP1 overexpression in Huh7 and LM3 cells. (C) WB analysis to detect the impact of USP1 overexpression on MCM3 in Huh7 and LM3 cells. (D) Co-IP assay to confirm the interaction between MCM3 and USP1 ( n = 3 biologically independent experiments). (E and F) RT-qPCR and WB analysis to verify the knockdown efficiency of USP1 . (G) EdU staining to assess the impact of USP1 knockdown on DNA replication in Huh7 and LM3 cells. (H) Transwell assay to evaluate the impact of USP1 knockdown on the invasion ability of Huh7 and LM3 cells (×100). Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05. For (A–C), (G), and (H), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments); For (E) and (F), statistical analysis was performed using a one-way analysis of variance (ANOVA) ( n = 3 biologically independent experiments).

Article Snippet: USP1 Forward 5′-CAGCTGGACCTGGAGAAACG-3′ Reverse 5′-TCCAGGTAGGCATCCACATC-3′ , Sangon Biotech , N/A.

Techniques: Quantitative RT-PCR, Over Expression, Co-Immunoprecipitation Assay, Knockdown, Staining, Transwell Assay, Two Tailed Test

Screening and validation of USP1 and MCM3 docking site mutations (A) RMSF values of USP1 and MCM3 over time. (B) RMSD values of USP1, MCM3, and USP1-MCM3 complex over time. (C) SASA values for the protein-ligand complexes over time. (D) Core residues of the USP1-MCM3 complex screened by molecular dynamics simulations. (E) Co-IP was used to confirm the top3 residues of the USP1-MCM3 complex. Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: Screening and validation of USP1 and MCM3 docking site mutations (A) RMSF values of USP1 and MCM3 over time. (B) RMSD values of USP1, MCM3, and USP1-MCM3 complex over time. (C) SASA values for the protein-ligand complexes over time. (D) Core residues of the USP1-MCM3 complex screened by molecular dynamics simulations. (E) Co-IP was used to confirm the top3 residues of the USP1-MCM3 complex. Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments).

Article Snippet: USP1 Forward 5′-CAGCTGGACCTGGAGAAACG-3′ Reverse 5′-TCCAGGTAGGCATCCACATC-3′ , Sangon Biotech , N/A.

Techniques: Biomarker Discovery, Co-Immunoprecipitation Assay

USP1 modulates MCM3 protein stability by preventing K48-linked polyubiquitination of MCM3 (A) WB used to assess MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and MG132 treatment for 8 h (B) WB used to analyze MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and CHX treatment for 0 h, 4 h, 8 h, and 12 h (C) WB used to detect the effect of USP1 knockdown on polyubiquitinated MCM3 in Huh7 and LM3 cells. (D) WB used to measure polyubiquitination levels of MCM3 in Huh7 and LM3 cells with USP1 knockdown after transfection of wild-type and mutant UB plasmids. For (A–D), n = 3 biologically independent experiments and representative images provided.

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: USP1 modulates MCM3 protein stability by preventing K48-linked polyubiquitination of MCM3 (A) WB used to assess MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and MG132 treatment for 8 h (B) WB used to analyze MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and CHX treatment for 0 h, 4 h, 8 h, and 12 h (C) WB used to detect the effect of USP1 knockdown on polyubiquitinated MCM3 in Huh7 and LM3 cells. (D) WB used to measure polyubiquitination levels of MCM3 in Huh7 and LM3 cells with USP1 knockdown after transfection of wild-type and mutant UB plasmids. For (A–D), n = 3 biologically independent experiments and representative images provided.

Article Snippet: USP1 Forward 5′-CAGCTGGACCTGGAGAAACG-3′ Reverse 5′-TCCAGGTAGGCATCCACATC-3′ , Sangon Biotech , N/A.

Techniques: Knockdown, Transfection, Mutagenesis

MCM3 is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 is overexpressed in HCC and is closely related to USP1 (A) Genes strongly associated with HCC stage and grade by WGCNA. (B) Venn diagram depicting the intersection of turquoise module genes, DEGs in HCC, and mitophagy-related genes from the GeneCards database. (C) ROC curve analysis was performed to assess the accuracy of MCM3 as a clinical diagnostic marker for HCC. (D) IHC analysis to assess the expression of MCM3 in HCC and paracancerous tissues ( n = 15 paired cancerous and paracancerous tissues per group), with representative staining images provided. (E) WB analysis of MCM3 expression in HCC and paracancerous tissues ( n = 8 paired cancerous and paracancerous tissues per group and 3 technical replicates per sample). (F) Spearman correlation analysis examining the relationship between USP1 and MCM3 expression. (G) Correlation analysis of MCM3 expression with common deubiquitinases based on the TCGA-LIHC database. Data are as mean ± SD, ∗∗∗∗ p < 0.01; ∗ p < 0.01. For (D) and (E), statistical analysis was performed using a paired t test.

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Diagnostic Assay, Marker, Expressing, Staining

MCM3 knockdown inhibits HCC progression (A and B) RT-qPCR and WB were used to evaluate the efficiency of MCM3 knockdown. (C) CCK-8 assay to evaluate the impact of MCM3 knockdown on the proliferation of Huh7 and LM3 cells. (D) EdU staining to detect the impact of MCM3 knockdown on DNA replication in Huh7 and LM3 cells. (E) Colony formation assay to assess the impact of MCM3 knockdown on the proliferation of Huh7 and LM3 cells. (F) Wound healing assay to examine the impact of MCM3 knockdown on Huh7 and LM3 cell migration (×100). (G) Transwell assay to evaluate the impact of MCM3 knockdown on Huh7 and LM3 cell invasion (×100). (H) Flow cytometry analysis of the effect of MCM3 knockdown on apoptosis in Huh7 and LM3 cells. (I) Flow cytometry analysis of the impact of MCM3 knockdown on the cell cycle in Huh7 and LM3 cells. Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (A) and (B), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments); for (C–I), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 knockdown inhibits HCC progression (A and B) RT-qPCR and WB were used to evaluate the efficiency of MCM3 knockdown. (C) CCK-8 assay to evaluate the impact of MCM3 knockdown on the proliferation of Huh7 and LM3 cells. (D) EdU staining to detect the impact of MCM3 knockdown on DNA replication in Huh7 and LM3 cells. (E) Colony formation assay to assess the impact of MCM3 knockdown on the proliferation of Huh7 and LM3 cells. (F) Wound healing assay to examine the impact of MCM3 knockdown on Huh7 and LM3 cell migration (×100). (G) Transwell assay to evaluate the impact of MCM3 knockdown on Huh7 and LM3 cell invasion (×100). (H) Flow cytometry analysis of the effect of MCM3 knockdown on apoptosis in Huh7 and LM3 cells. (I) Flow cytometry analysis of the impact of MCM3 knockdown on the cell cycle in Huh7 and LM3 cells. Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (A) and (B), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments); for (C–I), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Knockdown, Quantitative RT-PCR, CCK-8 Assay, Staining, Colony Assay, Wound Healing Assay, Migration, Transwell Assay, Flow Cytometry, Two Tailed Test

USP1 influences HCC proliferation and combined with MCM3 (A and B) RT-qPCR and WB were used to confirm the efficiency of USP1 overexpression in Huh7 and LM3 cells. (C) WB analysis to detect the impact of USP1 overexpression on MCM3 in Huh7 and LM3 cells. (D) Co-IP assay to confirm the interaction between MCM3 and USP1 ( n = 3 biologically independent experiments). (E and F) RT-qPCR and WB analysis to verify the knockdown efficiency of USP1 . (G) EdU staining to assess the impact of USP1 knockdown on DNA replication in Huh7 and LM3 cells. (H) Transwell assay to evaluate the impact of USP1 knockdown on the invasion ability of Huh7 and LM3 cells (×100). Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05. For (A–C), (G), and (H), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments); For (E) and (F), statistical analysis was performed using a one-way analysis of variance (ANOVA) ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: USP1 influences HCC proliferation and combined with MCM3 (A and B) RT-qPCR and WB were used to confirm the efficiency of USP1 overexpression in Huh7 and LM3 cells. (C) WB analysis to detect the impact of USP1 overexpression on MCM3 in Huh7 and LM3 cells. (D) Co-IP assay to confirm the interaction between MCM3 and USP1 ( n = 3 biologically independent experiments). (E and F) RT-qPCR and WB analysis to verify the knockdown efficiency of USP1 . (G) EdU staining to assess the impact of USP1 knockdown on DNA replication in Huh7 and LM3 cells. (H) Transwell assay to evaluate the impact of USP1 knockdown on the invasion ability of Huh7 and LM3 cells (×100). Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05. For (A–C), (G), and (H), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments); For (E) and (F), statistical analysis was performed using a one-way analysis of variance (ANOVA) ( n = 3 biologically independent experiments).

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Quantitative RT-PCR, Over Expression, Co-Immunoprecipitation Assay, Knockdown, Staining, Transwell Assay, Two Tailed Test

Screening and validation of USP1 and MCM3 docking site mutations (A) RMSF values of USP1 and MCM3 over time. (B) RMSD values of USP1, MCM3, and USP1-MCM3 complex over time. (C) SASA values for the protein-ligand complexes over time. (D) Core residues of the USP1-MCM3 complex screened by molecular dynamics simulations. (E) Co-IP was used to confirm the top3 residues of the USP1-MCM3 complex. Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: Screening and validation of USP1 and MCM3 docking site mutations (A) RMSF values of USP1 and MCM3 over time. (B) RMSD values of USP1, MCM3, and USP1-MCM3 complex over time. (C) SASA values for the protein-ligand complexes over time. (D) Core residues of the USP1-MCM3 complex screened by molecular dynamics simulations. (E) Co-IP was used to confirm the top3 residues of the USP1-MCM3 complex. Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns p ≥ 0.05. For (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments).

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Biomarker Discovery, Co-Immunoprecipitation Assay

MCM3 regulates HCC progression via mitophagy pathway (A)Volcano plots of differentially expressed genes (DEGs) in MCM3 -knockdown Huh7 cells. (B) KEGG signaling pathway enrichment plot of all DEGs. (C) Immunofluorescence analysis of the effect of MCM3 knockdown on mitochondrial autophagy flow in Huh7 and LM3 cells ( n = 3 biologically independent experiments). (D and E) Flow cytometry analysis of ROS levels and mitochondrial membrane potential in Huh7 and LM3 cells following MCM3 knockdown. (F) Transmission electron microscopy images showing the impact of MCM3 knockdown on mitophagy in Huh7 and LM3 cells ( n = 3 biologically independent experiments). Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01. For (D) and (E), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 regulates HCC progression via mitophagy pathway (A)Volcano plots of differentially expressed genes (DEGs) in MCM3 -knockdown Huh7 cells. (B) KEGG signaling pathway enrichment plot of all DEGs. (C) Immunofluorescence analysis of the effect of MCM3 knockdown on mitochondrial autophagy flow in Huh7 and LM3 cells ( n = 3 biologically independent experiments). (D and E) Flow cytometry analysis of ROS levels and mitochondrial membrane potential in Huh7 and LM3 cells following MCM3 knockdown. (F) Transmission electron microscopy images showing the impact of MCM3 knockdown on mitophagy in Huh7 and LM3 cells ( n = 3 biologically independent experiments). Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗∗ p < 0.01. For (D) and (E), statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Knockdown, Immunofluorescence, Flow Cytometry, Membrane, Transmission Assay, Electron Microscopy, Two Tailed Test

MCM3 regulates mitophagy by influencing the expression and localization of Nrf-2 (A) WB used to detect the impact of MCM3 knockdown on P62, LC3B II/I, TOMM20, FUNDC1, Parkin, and PINK1 in Huh7 and LM3 cells. (B) WB was used to assess the impact of MCM3 knockdown on Nucleus Nrf2 in Huh7 and LM3 cells. (C) IF was used to evaluate the impact of MCM3 knockdown on Nrf2 in Huh7 and LM3 cells ( n = 3 biologically independent experiments). (D) WB was used to measure the impact of MCM3 knockdown on HMOX-1 and NQO1 expression in Huh7 and LM3 cells, with or without THBQ. (E) WB was performed to detect the impact of MCM3 knockdown on P62, LC3B II/I, TOMM20, FUNDC1, Parkin, and PINK1 in Huh7 and LM3 cells, with or without THBQ. Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05, ns p ≥ 0.05. For (A), (D), and (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments); For B, statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 regulates mitophagy by influencing the expression and localization of Nrf-2 (A) WB used to detect the impact of MCM3 knockdown on P62, LC3B II/I, TOMM20, FUNDC1, Parkin, and PINK1 in Huh7 and LM3 cells. (B) WB was used to assess the impact of MCM3 knockdown on Nucleus Nrf2 in Huh7 and LM3 cells. (C) IF was used to evaluate the impact of MCM3 knockdown on Nrf2 in Huh7 and LM3 cells ( n = 3 biologically independent experiments). (D) WB was used to measure the impact of MCM3 knockdown on HMOX-1 and NQO1 expression in Huh7 and LM3 cells, with or without THBQ. (E) WB was performed to detect the impact of MCM3 knockdown on P62, LC3B II/I, TOMM20, FUNDC1, Parkin, and PINK1 in Huh7 and LM3 cells, with or without THBQ. Data are presented as mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05, ns p ≥ 0.05. For (A), (D), and (E), statistical analysis was performed using a one-way ANOVA ( n = 3 biologically independent experiments); For B, statistical analysis was performed using a two-tailed unpaired Student’s t test ( n = 3 biologically independent experiments).

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Expressing, Knockdown, Two Tailed Test

USP1 modulates MCM3 protein stability by preventing K48-linked polyubiquitination of MCM3 (A) WB used to assess MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and MG132 treatment for 8 h (B) WB used to analyze MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and CHX treatment for 0 h, 4 h, 8 h, and 12 h (C) WB used to detect the effect of USP1 knockdown on polyubiquitinated MCM3 in Huh7 and LM3 cells. (D) WB used to measure polyubiquitination levels of MCM3 in Huh7 and LM3 cells with USP1 knockdown after transfection of wild-type and mutant UB plasmids. For (A–D), n = 3 biologically independent experiments and representative images provided.

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: USP1 modulates MCM3 protein stability by preventing K48-linked polyubiquitination of MCM3 (A) WB used to assess MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and MG132 treatment for 8 h (B) WB used to analyze MCM3 and USP1 protein levels in Huh7 and LM3 cells with USP1 knockdown and CHX treatment for 0 h, 4 h, 8 h, and 12 h (C) WB used to detect the effect of USP1 knockdown on polyubiquitinated MCM3 in Huh7 and LM3 cells. (D) WB used to measure polyubiquitination levels of MCM3 in Huh7 and LM3 cells with USP1 knockdown after transfection of wild-type and mutant UB plasmids. For (A–D), n = 3 biologically independent experiments and representative images provided.

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Knockdown, Transfection, Mutagenesis

MCM3 knockdown inhibits HCC in vivo (A) Tumor volume changes following the transplantation of MCM3 knockdown cells, two-way ANOVA with Sidak’s multiple comparisons ( n = 5 mice per group). (B) Tumor size and weight after transplantation of MCM3 knockdown cells, unpaired t test ( n = 5 mice per group). (C–E) IHC analysis of tumors to detect the effects of MCM3 knockdown on FUNDC1 (C), TOMM20 (D), and Ki67 (E) ( n = 3 mice per group; representative staining images are provided). (F) TUNEL assay to assess the impact of MCM3 knockdown on tumor apoptosis ( n = 3 mice per group, with representative staining images provided). Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗ p < 0.05. For (A) and (B), statistical analysis was performed using a two-tailed unpaired Student’s t test.

Journal: iScience

Article Title: USP1 promotes hepatocellular carcinoma progression by modulating mitophagy via stabilizing MCM3 to regulate the Keap1-Nrf2 axis

doi: 10.1016/j.isci.2026.114927

Figure Lengend Snippet: MCM3 knockdown inhibits HCC in vivo (A) Tumor volume changes following the transplantation of MCM3 knockdown cells, two-way ANOVA with Sidak’s multiple comparisons ( n = 5 mice per group). (B) Tumor size and weight after transplantation of MCM3 knockdown cells, unpaired t test ( n = 5 mice per group). (C–E) IHC analysis of tumors to detect the effects of MCM3 knockdown on FUNDC1 (C), TOMM20 (D), and Ki67 (E) ( n = 3 mice per group; representative staining images are provided). (F) TUNEL assay to assess the impact of MCM3 knockdown on tumor apoptosis ( n = 3 mice per group, with representative staining images provided). Data are presented as mean ± SD. ∗∗∗ p < 0.001; ∗ p < 0.05. For (A) and (B), statistical analysis was performed using a two-tailed unpaired Student’s t test.

Article Snippet: MCM3 Forward 5′-TCAGAGAGATTACCTG GACTTCC-3′ Reverse 5′-TCAGCCGGTATTGGTTGTCAC-3′ , Sangon Biotech , N/A.

Techniques: Knockdown, In Vivo, Transplantation Assay, Staining, TUNEL Assay, Two Tailed Test