Review



aflatoxin m1 afm1  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    MedChemExpress aflatoxin m1 afm1
    Aflatoxin M1 Afm1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hy-n6699/Aflatoxin+M1/pm36588152-54-39-36
    Average 93 stars, based on 1 article reviews
    aflatoxin m1 afm1 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Concentration Assay:

    Article Title: Design of a new electrochemical aptasensor based on screen printed carbon electrode modified with gold nanoparticles for the detection of fumonisin B1 in maize flour.
    Article Snippet: consisted typically of three electrodes: the carbon working electrode (WE), the carbon counter electrode, and the Ag/AgCl reference electrode (RE). .. Sulfuric acid (H2SO4), potassium chloride (KCl), magnesium chloride (MgCl2), calcium chloride (CaCl2), sodium chloride (NaCl), Tris–HCl, Hydrogen tetracholoroaurate (HAuCl4), methanol (CH3OH), sodium phosphate dibasic (Na2HPO4), potassium phosphate monobasic (KH2PO4), potassium ferrocyanide (K4[Fe(CN)6]), potassium ferricyanide (K3[Fe(CN)6]), 2-mercaptoethanol (2-MCE), zearalenone (ZEN), Aflatoxin M1 (AFM1) and Aflatoxin B1 (AFB1) were purchased from Sigma-Aldrich. .. FB1aptamer ss-HSDNA sequence (5′ SH(CH2)6AGC AGC ACA GAG GTC AGA TGC GAT CTG GAT ATT ATT TTT GAT ACC CCT TT GGG AGA CAT CCT ATG CGT GCT ACC GTGAA-3′)

    Article Title: Design of a new electrochemical aptasensor based on screen printed carbon electrode modified with gold nanoparticles for the detection of fumonisin B1 in maize flour
    Article Snippet: consisted typically of three electrodes: the carbon working electrode (WE), the carbon counter electrode, and the Ag/AgCl reference electrode (RE). .. Sulfuric acid (H 2 SO 4 ), potassium chloride (KCl), magnesium chloride (MgCl 2 ), calcium chloride (CaCl 2 ), sodium chloride (NaCl), Tris–HCl, Hydrogen tetracholoroaurate (HAuCl 4 ), methanol (CH 3 OH), sodium phosphate dibasic (Na 2 HPO 4 ), potassium phosphate monobasic (KH 2 PO 4 ), potassium ferrocyanide (K 4 [Fe(CN) 6 ]), potassium ferricyanide (K 3 [Fe(CN) 6 ]), 2-mercaptoethanol (2-MCE), zearalenone (ZEN), Aflatoxin M1 (AFM1) and Aflatoxin B1 (AFB1) were purchased from Sigma-Aldrich. .. FB1-aptamer ss-HSDNA sequence (5′ SH(CH 2 ) 6 AGCAGCACAGAGGTCAGATGCGATCTGGATATTATTTTTGATACCCCTTT GGGAGACATCCTATGCGTGCTACCGTGAA-3′) was bought from The



    Similar Products

    aflatoxin m1 afm1  (MedChemExpress)
    93
    MedChemExpress aflatoxin m1 afm1
    Aflatoxin M1 Afm1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hy-n6699/Aflatoxin+M1/pm36588152-54-39-36
    Average 93 stars, based on 1 article reviews
    aflatoxin m1 afm1 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results