Review



ve cadherin  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Cell Signaling Technology Inc ve cadherin
    Ve Cadherin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/ppr0258460-221-27-29
    Average 93 stars, based on 12 article reviews
    ve cadherin - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Bacteria:

    Article Title: Stable flow-induced expression of KLK10 inhibits endothelial inflammation and atherosclerosis
    Article Snippet: .. Company tested cells free of mycoplasma, bacteria, yeast, and fungi Cell line THP1 Human Monocytes ATCC Cat TIB- 202 STR Profiling and mycoplasma testing done by ATCC Biological sample (human) Human Coronary Arteries Lifelink Georgia Deidentified human hearts not suitable for cardiac transplantation donated to LifeLink of Georgia Antibody KLK10 (Rabbit Polyclonal) Bioss Bioss Cat# bs- 2531R, RRID:AB_10882440 IF (1:100), WB (1:1000) Antibody CD31 (Rabbit Polyclonal) Abcam Abcam Cat# ab28364, RRID:AB_726362 IF (1:100) Antibody VCAM1 (Rabbit Monoclonal) Abcam Abcam Cat# ab134047, RRID:AB_2721053 IF (1:100) WB (1:1000) Antibody VE- Cadherin (Mouse monoclonal) Santacruz Santa Cruz Biotechnology Cat# sc- 9989, RRID:AB_2077957 IF (1:100) Antibody NFKB P65 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 8242, RRID:AB_10859369 IF (1:100) Antibody phospho- NFκB p65 S356 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 3033, RRID:AB_331284 WB (1:1000) Antibody Alexa Fluor Secondaries Thermo Fisher IF (1:500) Antibody Ki67 (Rabbit Polyclonal) Abcam Abcam Cat# ab15580, RRID:AB_443209 IF (1:100) Commercial assay or kit H&E Staining Kit American Mastertech KTHNEPT Commercial assay or kit Human KLK10 ELISA MyBioSource Cat. #: MBS009286 Continued on next page Continued Williams, Mahmoud, Liu et al. eLife 2022;11:e72579. .. DOI: https://doi.org/10.7554/eLife.72579 12 of 23 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Klk10 ELISA NovateinBio BG- MUS11429 Commercial assay or kit TUNEL Staining Kit Roche 12156792910 Chemical compound 2′,7′-bis(carboxyethyl)- 5 (6)- carboxyfluorescein- AM Thermo Fisher B1150 1 mg/ml Primers Human KLK10 For: GAGT GTGA GGTC TTCT ACCC TG Rev: ATGC CTTG GAGG GTCT CGTC AC Primers Mouse Klk10 For: CGC TAC TGA TGG TGC AAC TCT Rev: ATA GTC ACG CTC GCA CTG G Primers Human/Mouse 18s For: AGGA ATTG ACGG AAGG GCAC CA Rev: GTGC AGCC CCGG ACAT CTAA G Primers Human VCAM1 For: GATT CTGT GCCC ACAG TAAG GC Rev: TGGT CACA GAGC CACC TTCT TG Primers Human ICAM1 For: AGCG GCTG ACGT GTGC AGTA AT Rev: TCTG AGAC CTCT GGCT TCGT CA Software, algorithm Zen Blue Zeiss Confocal Microscopy Software, algorithm ImageJ NIH Image Analysis Other DAPI Mounting media Vector Biolabs H- 1200- 10 Methods – immunostaining of mouse artery sections an en face preparation of the aortic arch Other Oligofectamine Thermo Fisher 12252011 Methods – overexpression or knockdown experiments in vitro Other Lipofectamine Thermo Fisher L3000008 Methods – overexpression or knockdown experiments in vitro Continued

    Transplantation Assay:

    Article Title: Stable flow-induced expression of KLK10 inhibits endothelial inflammation and atherosclerosis
    Article Snippet: .. Company tested cells free of mycoplasma, bacteria, yeast, and fungi Cell line THP1 Human Monocytes ATCC Cat TIB- 202 STR Profiling and mycoplasma testing done by ATCC Biological sample (human) Human Coronary Arteries Lifelink Georgia Deidentified human hearts not suitable for cardiac transplantation donated to LifeLink of Georgia Antibody KLK10 (Rabbit Polyclonal) Bioss Bioss Cat# bs- 2531R, RRID:AB_10882440 IF (1:100), WB (1:1000) Antibody CD31 (Rabbit Polyclonal) Abcam Abcam Cat# ab28364, RRID:AB_726362 IF (1:100) Antibody VCAM1 (Rabbit Monoclonal) Abcam Abcam Cat# ab134047, RRID:AB_2721053 IF (1:100) WB (1:1000) Antibody VE- Cadherin (Mouse monoclonal) Santacruz Santa Cruz Biotechnology Cat# sc- 9989, RRID:AB_2077957 IF (1:100) Antibody NFKB P65 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 8242, RRID:AB_10859369 IF (1:100) Antibody phospho- NFκB p65 S356 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 3033, RRID:AB_331284 WB (1:1000) Antibody Alexa Fluor Secondaries Thermo Fisher IF (1:500) Antibody Ki67 (Rabbit Polyclonal) Abcam Abcam Cat# ab15580, RRID:AB_443209 IF (1:100) Commercial assay or kit H&E Staining Kit American Mastertech KTHNEPT Commercial assay or kit Human KLK10 ELISA MyBioSource Cat. #: MBS009286 Continued on next page Continued Williams, Mahmoud, Liu et al. eLife 2022;11:e72579. .. DOI: https://doi.org/10.7554/eLife.72579 12 of 23 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Klk10 ELISA NovateinBio BG- MUS11429 Commercial assay or kit TUNEL Staining Kit Roche 12156792910 Chemical compound 2′,7′-bis(carboxyethyl)- 5 (6)- carboxyfluorescein- AM Thermo Fisher B1150 1 mg/ml Primers Human KLK10 For: GAGT GTGA GGTC TTCT ACCC TG Rev: ATGC CTTG GAGG GTCT CGTC AC Primers Mouse Klk10 For: CGC TAC TGA TGG TGC AAC TCT Rev: ATA GTC ACG CTC GCA CTG G Primers Human/Mouse 18s For: AGGA ATTG ACGG AAGG GCAC CA Rev: GTGC AGCC CCGG ACAT CTAA G Primers Human VCAM1 For: GATT CTGT GCCC ACAG TAAG GC Rev: TGGT CACA GAGC CACC TTCT TG Primers Human ICAM1 For: AGCG GCTG ACGT GTGC AGTA AT Rev: TCTG AGAC CTCT GGCT TCGT CA Software, algorithm Zen Blue Zeiss Confocal Microscopy Software, algorithm ImageJ NIH Image Analysis Other DAPI Mounting media Vector Biolabs H- 1200- 10 Methods – immunostaining of mouse artery sections an en face preparation of the aortic arch Other Oligofectamine Thermo Fisher 12252011 Methods – overexpression or knockdown experiments in vitro Other Lipofectamine Thermo Fisher L3000008 Methods – overexpression or knockdown experiments in vitro Continued

    Western Blot:

    Article Title: Stable flow-induced expression of KLK10 inhibits endothelial inflammation and atherosclerosis
    Article Snippet: .. Company tested cells free of mycoplasma, bacteria, yeast, and fungi Cell line THP1 Human Monocytes ATCC Cat TIB- 202 STR Profiling and mycoplasma testing done by ATCC Biological sample (human) Human Coronary Arteries Lifelink Georgia Deidentified human hearts not suitable for cardiac transplantation donated to LifeLink of Georgia Antibody KLK10 (Rabbit Polyclonal) Bioss Bioss Cat# bs- 2531R, RRID:AB_10882440 IF (1:100), WB (1:1000) Antibody CD31 (Rabbit Polyclonal) Abcam Abcam Cat# ab28364, RRID:AB_726362 IF (1:100) Antibody VCAM1 (Rabbit Monoclonal) Abcam Abcam Cat# ab134047, RRID:AB_2721053 IF (1:100) WB (1:1000) Antibody VE- Cadherin (Mouse monoclonal) Santacruz Santa Cruz Biotechnology Cat# sc- 9989, RRID:AB_2077957 IF (1:100) Antibody NFKB P65 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 8242, RRID:AB_10859369 IF (1:100) Antibody phospho- NFκB p65 S356 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 3033, RRID:AB_331284 WB (1:1000) Antibody Alexa Fluor Secondaries Thermo Fisher IF (1:500) Antibody Ki67 (Rabbit Polyclonal) Abcam Abcam Cat# ab15580, RRID:AB_443209 IF (1:100) Commercial assay or kit H&E Staining Kit American Mastertech KTHNEPT Commercial assay or kit Human KLK10 ELISA MyBioSource Cat. #: MBS009286 Continued on next page Continued Williams, Mahmoud, Liu et al. eLife 2022;11:e72579. .. DOI: https://doi.org/10.7554/eLife.72579 12 of 23 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Klk10 ELISA NovateinBio BG- MUS11429 Commercial assay or kit TUNEL Staining Kit Roche 12156792910 Chemical compound 2′,7′-bis(carboxyethyl)- 5 (6)- carboxyfluorescein- AM Thermo Fisher B1150 1 mg/ml Primers Human KLK10 For: GAGT GTGA GGTC TTCT ACCC TG Rev: ATGC CTTG GAGG GTCT CGTC AC Primers Mouse Klk10 For: CGC TAC TGA TGG TGC AAC TCT Rev: ATA GTC ACG CTC GCA CTG G Primers Human/Mouse 18s For: AGGA ATTG ACGG AAGG GCAC CA Rev: GTGC AGCC CCGG ACAT CTAA G Primers Human VCAM1 For: GATT CTGT GCCC ACAG TAAG GC Rev: TGGT CACA GAGC CACC TTCT TG Primers Human ICAM1 For: AGCG GCTG ACGT GTGC AGTA AT Rev: TCTG AGAC CTCT GGCT TCGT CA Software, algorithm Zen Blue Zeiss Confocal Microscopy Software, algorithm ImageJ NIH Image Analysis Other DAPI Mounting media Vector Biolabs H- 1200- 10 Methods – immunostaining of mouse artery sections an en face preparation of the aortic arch Other Oligofectamine Thermo Fisher 12252011 Methods – overexpression or knockdown experiments in vitro Other Lipofectamine Thermo Fisher L3000008 Methods – overexpression or knockdown experiments in vitro Continued

    Staining:

    Article Title: Stable flow-induced expression of KLK10 inhibits endothelial inflammation and atherosclerosis
    Article Snippet: .. Company tested cells free of mycoplasma, bacteria, yeast, and fungi Cell line THP1 Human Monocytes ATCC Cat TIB- 202 STR Profiling and mycoplasma testing done by ATCC Biological sample (human) Human Coronary Arteries Lifelink Georgia Deidentified human hearts not suitable for cardiac transplantation donated to LifeLink of Georgia Antibody KLK10 (Rabbit Polyclonal) Bioss Bioss Cat# bs- 2531R, RRID:AB_10882440 IF (1:100), WB (1:1000) Antibody CD31 (Rabbit Polyclonal) Abcam Abcam Cat# ab28364, RRID:AB_726362 IF (1:100) Antibody VCAM1 (Rabbit Monoclonal) Abcam Abcam Cat# ab134047, RRID:AB_2721053 IF (1:100) WB (1:1000) Antibody VE- Cadherin (Mouse monoclonal) Santacruz Santa Cruz Biotechnology Cat# sc- 9989, RRID:AB_2077957 IF (1:100) Antibody NFKB P65 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 8242, RRID:AB_10859369 IF (1:100) Antibody phospho- NFκB p65 S356 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 3033, RRID:AB_331284 WB (1:1000) Antibody Alexa Fluor Secondaries Thermo Fisher IF (1:500) Antibody Ki67 (Rabbit Polyclonal) Abcam Abcam Cat# ab15580, RRID:AB_443209 IF (1:100) Commercial assay or kit H&E Staining Kit American Mastertech KTHNEPT Commercial assay or kit Human KLK10 ELISA MyBioSource Cat. #: MBS009286 Continued on next page Continued Williams, Mahmoud, Liu et al. eLife 2022;11:e72579. .. DOI: https://doi.org/10.7554/eLife.72579 12 of 23 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Klk10 ELISA NovateinBio BG- MUS11429 Commercial assay or kit TUNEL Staining Kit Roche 12156792910 Chemical compound 2′,7′-bis(carboxyethyl)- 5 (6)- carboxyfluorescein- AM Thermo Fisher B1150 1 mg/ml Primers Human KLK10 For: GAGT GTGA GGTC TTCT ACCC TG Rev: ATGC CTTG GAGG GTCT CGTC AC Primers Mouse Klk10 For: CGC TAC TGA TGG TGC AAC TCT Rev: ATA GTC ACG CTC GCA CTG G Primers Human/Mouse 18s For: AGGA ATTG ACGG AAGG GCAC CA Rev: GTGC AGCC CCGG ACAT CTAA G Primers Human VCAM1 For: GATT CTGT GCCC ACAG TAAG GC Rev: TGGT CACA GAGC CACC TTCT TG Primers Human ICAM1 For: AGCG GCTG ACGT GTGC AGTA AT Rev: TCTG AGAC CTCT GGCT TCGT CA Software, algorithm Zen Blue Zeiss Confocal Microscopy Software, algorithm ImageJ NIH Image Analysis Other DAPI Mounting media Vector Biolabs H- 1200- 10 Methods – immunostaining of mouse artery sections an en face preparation of the aortic arch Other Oligofectamine Thermo Fisher 12252011 Methods – overexpression or knockdown experiments in vitro Other Lipofectamine Thermo Fisher L3000008 Methods – overexpression or knockdown experiments in vitro Continued

    Enzyme-linked Immunosorbent Assay:

    Article Title: Stable flow-induced expression of KLK10 inhibits endothelial inflammation and atherosclerosis
    Article Snippet: .. Company tested cells free of mycoplasma, bacteria, yeast, and fungi Cell line THP1 Human Monocytes ATCC Cat TIB- 202 STR Profiling and mycoplasma testing done by ATCC Biological sample (human) Human Coronary Arteries Lifelink Georgia Deidentified human hearts not suitable for cardiac transplantation donated to LifeLink of Georgia Antibody KLK10 (Rabbit Polyclonal) Bioss Bioss Cat# bs- 2531R, RRID:AB_10882440 IF (1:100), WB (1:1000) Antibody CD31 (Rabbit Polyclonal) Abcam Abcam Cat# ab28364, RRID:AB_726362 IF (1:100) Antibody VCAM1 (Rabbit Monoclonal) Abcam Abcam Cat# ab134047, RRID:AB_2721053 IF (1:100) WB (1:1000) Antibody VE- Cadherin (Mouse monoclonal) Santacruz Santa Cruz Biotechnology Cat# sc- 9989, RRID:AB_2077957 IF (1:100) Antibody NFKB P65 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 8242, RRID:AB_10859369 IF (1:100) Antibody phospho- NFκB p65 S356 (Rabbit Monoclonal) Cell Signaling Cell Signaling Technology Cat# 3033, RRID:AB_331284 WB (1:1000) Antibody Alexa Fluor Secondaries Thermo Fisher IF (1:500) Antibody Ki67 (Rabbit Polyclonal) Abcam Abcam Cat# ab15580, RRID:AB_443209 IF (1:100) Commercial assay or kit H&E Staining Kit American Mastertech KTHNEPT Commercial assay or kit Human KLK10 ELISA MyBioSource Cat. #: MBS009286 Continued on next page Continued Williams, Mahmoud, Liu et al. eLife 2022;11:e72579. .. DOI: https://doi.org/10.7554/eLife.72579 12 of 23 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Commercial assay or kit Mouse Klk10 ELISA NovateinBio BG- MUS11429 Commercial assay or kit TUNEL Staining Kit Roche 12156792910 Chemical compound 2′,7′-bis(carboxyethyl)- 5 (6)- carboxyfluorescein- AM Thermo Fisher B1150 1 mg/ml Primers Human KLK10 For: GAGT GTGA GGTC TTCT ACCC TG Rev: ATGC CTTG GAGG GTCT CGTC AC Primers Mouse Klk10 For: CGC TAC TGA TGG TGC AAC TCT Rev: ATA GTC ACG CTC GCA CTG G Primers Human/Mouse 18s For: AGGA ATTG ACGG AAGG GCAC CA Rev: GTGC AGCC CCGG ACAT CTAA G Primers Human VCAM1 For: GATT CTGT GCCC ACAG TAAG GC Rev: TGGT CACA GAGC CACC TTCT TG Primers Human ICAM1 For: AGCG GCTG ACGT GTGC AGTA AT Rev: TCTG AGAC CTCT GGCT TCGT CA Software, algorithm Zen Blue Zeiss Confocal Microscopy Software, algorithm ImageJ NIH Image Analysis Other DAPI Mounting media Vector Biolabs H- 1200- 10 Methods – immunostaining of mouse artery sections an en face preparation of the aortic arch Other Oligofectamine Thermo Fisher 12252011 Methods – overexpression or knockdown experiments in vitro Other Lipofectamine Thermo Fisher L3000008 Methods – overexpression or knockdown experiments in vitro Continued

    Incubation:

    Article Title: An Integrated Stress Response Pathway activates Perivascular Cancer-Associated Fibroblasts to Drive Angiogenesis and Tumor Progression
    Article Snippet: .. Primary antibodies against ATF4 (Cell Signaling Technology, Cat#11815, RRID:AB_2616025), Collagen Type I (MilliporeSigma, Cat#AB765P, RRID:AB_92259), p-SMAD3 (Cell Signaling Technology, Cat#9520, RRID:AB_2193207), SMAD2/3 (Cell Signaling Technology, Cat#8685, RRID:AB_10889933), VE cadherin (Cell Signaling Technology, Cat#2158, RRID:AB_2077970), b-actin (Cell Signaling Technology, Cat#3700, RRID:AB_2242334) and b-tubulin (Cell Signaling Technology, Cat#2146, RRID:AB_2210545) were added at 1:1000 and incubated overnight at 4 °C. .. Membranes were washed and secondary antibodies (ThermoFisher: Cat#31460, RRID:AB_228341 or Cat# 31430, RRID:AB_228307) were added at 1:2000.

    Recombinant:

    Article Title: Differential HDAC6 Activity Modulates Ciliogenesis and Subsequent Mechanosensing of Endothelial Cells Derived from Pluripotent Stem Cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dapi (1:10,000) Roche 10236276 AlexaFluor 488 (1:1,000) Life Technologies A-11008; RRID: AB_143165 AlexaFluor 546 (1:1,000) Life Technologies A-10036; RRID: AB_2534012 AlexaFluor 647 (1:1,000) Life Technologies A-31573; RRID: AB_2536183 VECAD-PE (1:10) BD 560410; RRID: AB_1645502 CD31-PE (1:10) BD 555446; RRID: AB_395839 PDGFR-B (1:10) R&D FAB1263P; RRID: AB_2162793 VECAD (F-8) (1:100) Santa Cruz Sc-9989; RRID: AB_2077957 vWF (H-300) (1:100) Santa Cruz Sc-14014; RRID: AB_2241707 eNOS (1:100) BD 610297; RRID: AB_397691 PECAM-1/CD31 (1:100) Dako MO823; RRID: AB_2114471 Acetylated alpha-tubulin (1:100) Santa Cruz Sc-23950; RRID: AB_628409 SM22a (1:100) Ab Cam Ab 14106; RRID: AB_443021 HDAC6(D2E5) (1:1000) CST 7558S; RRID: AB_10891804 Acetylated alpha-tubulin (D20G3) CST 5335S; RRID: AB_10544694 GAPDH-HRP (1:20,000) Proteintech HRP-60004 Anti-rabbit IgG, HRP-linked antibody (1:3000) CST 7074S; RRID: AB_2099233 Chemicals, Peptides, and Recombinant Proteins Recombinant Human FGF basic (146 aa) Protein, CF R&D Systems 233-FB/CF Recombinant Human VEGF165 Protein, CF R&D Systems 293-VE-050 EGM-2 (ECFC media) Lonza CC-3162 EC Growth Medium 2 PromoCell C-22111 Medium 199 (10X) Thermo Fisher Scientific 11825015 Medium 199, no phenol red Thermo Fisher Scientific 11043023 Tubastatin A Santa Cruz Biotechnology sc-364640 MACs Separation Column Miltenyi Biotec 130042201 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 CHIR99021 STEMCELL Technologies 720542-10mg SB-431542 R&D Systems 1614/10 Y-27632 (Dihydrochloride) STEMCELL Technologies 72304 ES DMEM/F12 GlobalStem GSM1102 Hyclone FBS Hyclone SH30071.03 Essential 8 Medium kit Thermo Fisher Scientific A1517001 Essential 6 Medium Thermo Fisher Scientific A1516401 Corning Collagen IV mouse, 1mg Corning 354233 Collagen I, High Concentration, Rat Tail, 100mg Corning 354249 Criterion precast Tris-HCL, gel 4-20% 18w Criterion 3450033 RIPA buffer Thermo Fisher Scientific 89900 Halt Protease and phosphotase inhibitor cocktail (100X) Thermo Fisher Scientific 78440 Super signal west pico chemiluminescent Thermo Fisher Scientific 34087 Pierce Modified Lowry Protein Assay Kit Thermo Fisher Scientific 23240 Pierce BCA Protein Assay kit Thermo Fisher Scientific 23227 Pageruler plus prestained protein ladder Thermo Fisher Scientific 26619 (Continued on next page) Cell Reports 24, 895–908.e1–e6, July 24, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER iblot transfer stack nitrocellulose regular Thermo Fisher Scientific IB23001 20X Bolt MOPS SDS Running Buffer Thermo Fisher Scientific B0001 NE-PER Nuclear and Cytoplasmic Extraction Reagents Thermo Fisher Scientific 78835 MagicMark XP Western protein standard Thermo Fisher Scientific LC5603 iBlot 2 Transfer Stacks, PVDF, regular size Thermo Fisher Scientific IB24001 Critical Commercial Assays Trizol reagent Thermo Fisher Scientific 15596018 M-MLV Reverse Transcriptase Promega M1701 RNaseOUT Thermo Fisher Scientific 10777019 RT PCR master mix Thermo Fisher Scientific 4369016 Deposited Data hiPSC-EC cDNA microarray This Study GEO: GSE115870 Experimental Models: Cell Lines HUVEC single donor Promocell C-12200 HUAEC Promocell C-12202 Endothelial Colony Forming Cells (ECFCs) STAR Methods N/A iPSCs and Derivatives STAR Methods N/A Irradiated Mouse Embryonic Fibroblasts R&D Systems PSC001 Oligonucleotides Random primers Promega C1181 TaqMan Gene Arrays, see Table S2 Thermo Fisher Scientific N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Imaris BITPLANE http://www.bitplane.com/imaris-for- cell-biologists GraphPad GraphPad Software https://www.graphpad.com/scientific- software/prism/ Illustrator Adobe https://www.adobe.com

    Article Title: Stem cell-derived vessels-on-chip for cardiovascular disease modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies VE-Cadherin, rabbit Cell Signaling RRID: AB_2077970 PECAM-1, rabbit Thermo Fisher Scientific RRID: AB_10981955 DLL4, rabbit Cell Signaling RRID: AB_2800263 ARP3, mouse Sigma Aldrich RRID: AB_476749 KLF4, rabbit Thermo Fisher Scientific RRID: AB_2898967 Claudin5, Thermo Fisher Scientific RRID: AB_2809891 Angiopoietin2 Thermo Fisher Scientific RRID: AB_2544773 PECAM-1, mouse Cell Signaling RRID: AB_2160882 Alexa Fluor 555, donkey anti-rabbit Thermo Fisher Scientific RRID: AB_162543 Alexa Fluor 488, donkey anti-mouse Thermo Fisher Scientific RRID: AB_141607 Alexa Fluor 647, goat anti-mouse Thermo Fisher Scientific RRID: AB_2535809 CD31-FITC BD Cat#555445; RRID AB_395838 CD140b-PE BD Cat#558821; RRID:AB_397132 Chemicals, recombinant proteins FITC-dextran 2000 kDa Sigma Aldrich FD2000S DAPI Sigma Aldrich D9542 Live/Dead Viability/Toxicity Kit Thermo Fisher Scientific L3224 Collagenase P Roche 11213857001 oxLDL Thermo Fisher Scientific L34357 Dil-oxLDL Thermo Fisher Scientific L34358 BODIPY Thermo Fisher Scientific D3922 Phalloidin-Atto-647 Abcam ab176759 Hoechst33342 Thermo Fisher Scientific 62249 TBHP abcam ab113851 TY52156 Sigma Aldrich 5330620001 Pro3dure GR-10 resin Litholabs HX10031 VEGFA Peprotech 100-20-250 FGF2 Miltenyi Biotec 130-093-838 CHIR99021 Axon Medchem BV 1385 BMP4 PeproTech 120-05ET-10 Forskolin Abcam Ab120058 Critical commercial assays Fluorometric Nitric Oxide Assay Kit Sigma Aldrich 482655-1KIT Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics 1000269 Chromium Next GEM Chip G Single Cell Kit 10x Genomics 1000127 NovaSeq SP flow cell Illumina PreOmics’ iST Kit Preomics GmbH P.O.00001 Green fluorescent CellROX Sigma Aldrich C10444 Experimental models: Cell lines HiPSC HMGUi001-A Software and algorithms Python (version 3.9.12) python https://www.python.org/ Jupyter lab (version 3.4.8) jupyter https://jupyter.org/ (Continued on next page) 16 Cell Reports 43, 114008, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Scrublet Wolock et al.59 https://github.com/swolock/scrublet Scanpy (version 1.9.1) Scverse project https://github.com/scverse/scanpy scVelo (version 0.2.5) Theis lab https://github.com/theislab/scvelo All source code files used within this paper are published on Github Meier lab GitHub: https://github.com/MeierLabMiBioEng/ StemCell-derivedVessel-on-chip Deposited data All scRNA seq data sets are deposited at GEO.

    Article Title: APOL1 risk variants in individuals of African genetic ancestry drive endothelial cell defects that exacerbate sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Caspase-1 Adipogen Cat#AG-20B-0042-C100; RRID: AB_2755041 Anti-GAPDH CST Cat#2118; RRID: AB_561053 Anti-GSMD Abcam Cat#ab209845; RRID: AB_2783550 Anti-APOL1 Proteintech Cat#66124-1-Ig; RRID: AB_2881523 Anti-APOL1 Genentech Rabmab 5.17D12 Anti-GFP Abcam Cat#AB6673; RRID: AB_305643 Anti-NLRP3 Adipogen Cat#AG-20B-0014C100; RRID: AB_2885199 Anti-LC3II CST Cat#2775; RRID: AB_915950 Anti-CD31 Abcam Cat#ab24590; RRID: AB_448167 Anti-Icam1 Abcam Cat#ab179707; RRID: AB_2814769 Anti-Vcam1 Abcam Cat#ab134047; RRID: AB_2721053 Anti-Caveolin-1 CST Cat#3267; RRID: AB_2275453 Anti-Enos Abcam Cat#ab5589; RRID: AB_304967 Anti-Hsp60 CST Cat#12165; RRID: AB_2636980 Anti-Cox4 R&D Systems Cat#MAB6980; RRID: AB_10973832 Anti-STING CST Cat#13647s; RRID: AB_2732796 Anti-phosphorylated STING CST Cat#19781s; RRID: AB_2737062 Anti-cGAS CST Cat#31659S; RRID: AB_2799008 Anti-TBK1 CST Cat#3504S; RRID: AB_2255663 Anti-phosphorylated TBK1 CST Cat5483; RRID: AB_10693472 Anti-IRF3 CST Cat11904T; RRID: AB_2722521 Anti-phosphorylated IFR3 CST Cat#37829; RRID: AB_2799121 Anti-P65 CST Cat#8242; RRID: AB_10859369 Anti-Phospho-NF-kB p65 CST Cat#3033; RRID: AB_331284 Monoclonal Anti-b-Actin Peroxidase antibody Sigma Aldrich Cat#A3854; RRID: AB_262011 Anti-VE-cadherin Santa Cruz Cat#sc-6458; RRID: AB_2077955 OXPHOS antibody cocktail Abcam Cat#ab110413; RRID: AB_2629281 Anti-p62 CST Cat#5114; RRID: AB_10624872 Donkey anti-Rabbit IgG (H+L) Alexa Fluor 555 Invitrogen Cat#A31572; RRID: AB_162543 Chicken anti-Mouse IgG (H+L), Alexa Fluor 488 Invitrogen Cat#21200; RRID: AB_2535786 Chemicals, peptides, and recombinant proteins LPS (Escherichia. coli O26:B6) Sigma-Aldrich Cat#L8274 VX765 Cayman Cat#CAYM-28825-50 Disulfiram Cayman Cat#97-77-8 C176 Bio Vision Cat#B2341 Evans blue dye Sigma Cat#E2129 CD31 MicroBeads, mouse miltenyi biotec Cat#130-097-418 TET system approved FBS Clontech Cat#631106 Microvascular EBM-2 Lonza Cat#cc-3162 Hydrogen peroxide solution 30% Sigma H1009-500ML Trizol Invitrogen Cat#15596018 cDNA Reverse Transcription Kit Applied Biosystems Cat#4368813 Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367659 RIPA buffer Cell signaling Cat#9806 (Continued on next page) e1 Immunity 54, 2632–2649.e1–e6, November 9, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease cocktail Roche Cat#11836153001 BCA protein assay Thermo Scientific Cat#23225 Western Blotting Substrate Pierce Cat#32106 Lipofectamine 3000 reagents Thermo Fisher Scientific Cat#11668019 LysoTracker Blue DND-22 Thermo Fisher Scientific Cat#L7525 ECIS Cultureware Disposable Electrode Arrays Applied BioPhysics 8W10E+ (8 Well PET) l-cysteine Sigma Cat#C7352-25G Gelatin solution Sigma Cat#G1393-100ML JC-1 Invitrogen Cat#T3168 Digitonin EMD Millipore Cat#11024-24-1 DNeasy Blood and Tissue kit QIAGEN Cat#69506 COX8-EGFP-mCherry plasmid Addgene Cat#78520 Hs-APOL1 -C probe bio-techne Cat#459791 APOL1-No-XMm-C2 bio-techne Cat#459798-C2 Mm-Nlrp3 bio-techne Cat#439571 Hs-PECAM1-O1 bio-techne Cat#487381 Critical commercial assays Mouse albumin specific ELISA Bethyl Laboratories Cat#E99-134 Creatinine reagent Diazyme Cat#DZ072B RNAscope 2.5 HD Duplex Detection Kit bio-techne Cat#322436 Multi Tissue dissociation kit 1 Miltenyi Cat#130-110-2011 APOL1 ELISA Kit Proteintech Cat#KE00047 Mouse IL-1 beta ELISA Kit R&D Systems MLB00C Mouse TNF-alpha R&D Systems MTA00B Il-10 ELISA Kit R&D Systems Cat#M1000B Angpt2 ELISA Kit R&D Systems Cat#MANG20 Myeloperoxidase assay kit Sigma Cat#MAK068-1KT Expermental models: Organisms/strains Cdh5 tTA Jackson Laboratory Stock#013585 GT26.rtTA Jackson Laboratory Stock#5670 Nlrp3KO Jackson Laboratory Stock#21302 STING KO Jackson Laboratory Stock#025805 Caspase1/11 KO Jackson Laboratory Stock#16621 Gsdmd KO Jackson Laboratory Stock#032410 Alb-Cre Jackson Laboratory Stock#003574

    Concentration Assay:

    Article Title: Differential HDAC6 Activity Modulates Ciliogenesis and Subsequent Mechanosensing of Endothelial Cells Derived from Pluripotent Stem Cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dapi (1:10,000) Roche 10236276 AlexaFluor 488 (1:1,000) Life Technologies A-11008; RRID: AB_143165 AlexaFluor 546 (1:1,000) Life Technologies A-10036; RRID: AB_2534012 AlexaFluor 647 (1:1,000) Life Technologies A-31573; RRID: AB_2536183 VECAD-PE (1:10) BD 560410; RRID: AB_1645502 CD31-PE (1:10) BD 555446; RRID: AB_395839 PDGFR-B (1:10) R&D FAB1263P; RRID: AB_2162793 VECAD (F-8) (1:100) Santa Cruz Sc-9989; RRID: AB_2077957 vWF (H-300) (1:100) Santa Cruz Sc-14014; RRID: AB_2241707 eNOS (1:100) BD 610297; RRID: AB_397691 PECAM-1/CD31 (1:100) Dako MO823; RRID: AB_2114471 Acetylated alpha-tubulin (1:100) Santa Cruz Sc-23950; RRID: AB_628409 SM22a (1:100) Ab Cam Ab 14106; RRID: AB_443021 HDAC6(D2E5) (1:1000) CST 7558S; RRID: AB_10891804 Acetylated alpha-tubulin (D20G3) CST 5335S; RRID: AB_10544694 GAPDH-HRP (1:20,000) Proteintech HRP-60004 Anti-rabbit IgG, HRP-linked antibody (1:3000) CST 7074S; RRID: AB_2099233 Chemicals, Peptides, and Recombinant Proteins Recombinant Human FGF basic (146 aa) Protein, CF R&D Systems 233-FB/CF Recombinant Human VEGF165 Protein, CF R&D Systems 293-VE-050 EGM-2 (ECFC media) Lonza CC-3162 EC Growth Medium 2 PromoCell C-22111 Medium 199 (10X) Thermo Fisher Scientific 11825015 Medium 199, no phenol red Thermo Fisher Scientific 11043023 Tubastatin A Santa Cruz Biotechnology sc-364640 MACs Separation Column Miltenyi Biotec 130042201 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 CHIR99021 STEMCELL Technologies 720542-10mg SB-431542 R&D Systems 1614/10 Y-27632 (Dihydrochloride) STEMCELL Technologies 72304 ES DMEM/F12 GlobalStem GSM1102 Hyclone FBS Hyclone SH30071.03 Essential 8 Medium kit Thermo Fisher Scientific A1517001 Essential 6 Medium Thermo Fisher Scientific A1516401 Corning Collagen IV mouse, 1mg Corning 354233 Collagen I, High Concentration, Rat Tail, 100mg Corning 354249 Criterion precast Tris-HCL, gel 4-20% 18w Criterion 3450033 RIPA buffer Thermo Fisher Scientific 89900 Halt Protease and phosphotase inhibitor cocktail (100X) Thermo Fisher Scientific 78440 Super signal west pico chemiluminescent Thermo Fisher Scientific 34087 Pierce Modified Lowry Protein Assay Kit Thermo Fisher Scientific 23240 Pierce BCA Protein Assay kit Thermo Fisher Scientific 23227 Pageruler plus prestained protein ladder Thermo Fisher Scientific 26619 (Continued on next page) Cell Reports 24, 895–908.e1–e6, July 24, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER iblot transfer stack nitrocellulose regular Thermo Fisher Scientific IB23001 20X Bolt MOPS SDS Running Buffer Thermo Fisher Scientific B0001 NE-PER Nuclear and Cytoplasmic Extraction Reagents Thermo Fisher Scientific 78835 MagicMark XP Western protein standard Thermo Fisher Scientific LC5603 iBlot 2 Transfer Stacks, PVDF, regular size Thermo Fisher Scientific IB24001 Critical Commercial Assays Trizol reagent Thermo Fisher Scientific 15596018 M-MLV Reverse Transcriptase Promega M1701 RNaseOUT Thermo Fisher Scientific 10777019 RT PCR master mix Thermo Fisher Scientific 4369016 Deposited Data hiPSC-EC cDNA microarray This Study GEO: GSE115870 Experimental Models: Cell Lines HUVEC single donor Promocell C-12200 HUAEC Promocell C-12202 Endothelial Colony Forming Cells (ECFCs) STAR Methods N/A iPSCs and Derivatives STAR Methods N/A Irradiated Mouse Embryonic Fibroblasts R&D Systems PSC001 Oligonucleotides Random primers Promega C1181 TaqMan Gene Arrays, see Table S2 Thermo Fisher Scientific N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Imaris BITPLANE http://www.bitplane.com/imaris-for- cell-biologists GraphPad GraphPad Software https://www.graphpad.com/scientific- software/prism/ Illustrator Adobe https://www.adobe.com

    Modification:

    Article Title: Differential HDAC6 Activity Modulates Ciliogenesis and Subsequent Mechanosensing of Endothelial Cells Derived from Pluripotent Stem Cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dapi (1:10,000) Roche 10236276 AlexaFluor 488 (1:1,000) Life Technologies A-11008; RRID: AB_143165 AlexaFluor 546 (1:1,000) Life Technologies A-10036; RRID: AB_2534012 AlexaFluor 647 (1:1,000) Life Technologies A-31573; RRID: AB_2536183 VECAD-PE (1:10) BD 560410; RRID: AB_1645502 CD31-PE (1:10) BD 555446; RRID: AB_395839 PDGFR-B (1:10) R&D FAB1263P; RRID: AB_2162793 VECAD (F-8) (1:100) Santa Cruz Sc-9989; RRID: AB_2077957 vWF (H-300) (1:100) Santa Cruz Sc-14014; RRID: AB_2241707 eNOS (1:100) BD 610297; RRID: AB_397691 PECAM-1/CD31 (1:100) Dako MO823; RRID: AB_2114471 Acetylated alpha-tubulin (1:100) Santa Cruz Sc-23950; RRID: AB_628409 SM22a (1:100) Ab Cam Ab 14106; RRID: AB_443021 HDAC6(D2E5) (1:1000) CST 7558S; RRID: AB_10891804 Acetylated alpha-tubulin (D20G3) CST 5335S; RRID: AB_10544694 GAPDH-HRP (1:20,000) Proteintech HRP-60004 Anti-rabbit IgG, HRP-linked antibody (1:3000) CST 7074S; RRID: AB_2099233 Chemicals, Peptides, and Recombinant Proteins Recombinant Human FGF basic (146 aa) Protein, CF R&D Systems 233-FB/CF Recombinant Human VEGF165 Protein, CF R&D Systems 293-VE-050 EGM-2 (ECFC media) Lonza CC-3162 EC Growth Medium 2 PromoCell C-22111 Medium 199 (10X) Thermo Fisher Scientific 11825015 Medium 199, no phenol red Thermo Fisher Scientific 11043023 Tubastatin A Santa Cruz Biotechnology sc-364640 MACs Separation Column Miltenyi Biotec 130042201 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 CHIR99021 STEMCELL Technologies 720542-10mg SB-431542 R&D Systems 1614/10 Y-27632 (Dihydrochloride) STEMCELL Technologies 72304 ES DMEM/F12 GlobalStem GSM1102 Hyclone FBS Hyclone SH30071.03 Essential 8 Medium kit Thermo Fisher Scientific A1517001 Essential 6 Medium Thermo Fisher Scientific A1516401 Corning Collagen IV mouse, 1mg Corning 354233 Collagen I, High Concentration, Rat Tail, 100mg Corning 354249 Criterion precast Tris-HCL, gel 4-20% 18w Criterion 3450033 RIPA buffer Thermo Fisher Scientific 89900 Halt Protease and phosphotase inhibitor cocktail (100X) Thermo Fisher Scientific 78440 Super signal west pico chemiluminescent Thermo Fisher Scientific 34087 Pierce Modified Lowry Protein Assay Kit Thermo Fisher Scientific 23240 Pierce BCA Protein Assay kit Thermo Fisher Scientific 23227 Pageruler plus prestained protein ladder Thermo Fisher Scientific 26619 (Continued on next page) Cell Reports 24, 895–908.e1–e6, July 24, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER iblot transfer stack nitrocellulose regular Thermo Fisher Scientific IB23001 20X Bolt MOPS SDS Running Buffer Thermo Fisher Scientific B0001 NE-PER Nuclear and Cytoplasmic Extraction Reagents Thermo Fisher Scientific 78835 MagicMark XP Western protein standard Thermo Fisher Scientific LC5603 iBlot 2 Transfer Stacks, PVDF, regular size Thermo Fisher Scientific IB24001 Critical Commercial Assays Trizol reagent Thermo Fisher Scientific 15596018 M-MLV Reverse Transcriptase Promega M1701 RNaseOUT Thermo Fisher Scientific 10777019 RT PCR master mix Thermo Fisher Scientific 4369016 Deposited Data hiPSC-EC cDNA microarray This Study GEO: GSE115870 Experimental Models: Cell Lines HUVEC single donor Promocell C-12200 HUAEC Promocell C-12202 Endothelial Colony Forming Cells (ECFCs) STAR Methods N/A iPSCs and Derivatives STAR Methods N/A Irradiated Mouse Embryonic Fibroblasts R&D Systems PSC001 Oligonucleotides Random primers Promega C1181 TaqMan Gene Arrays, see Table S2 Thermo Fisher Scientific N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Imaris BITPLANE http://www.bitplane.com/imaris-for- cell-biologists GraphPad GraphPad Software https://www.graphpad.com/scientific- software/prism/ Illustrator Adobe https://www.adobe.com

    Bicinchoninic Acid Protein Assay:

    Article Title: Differential HDAC6 Activity Modulates Ciliogenesis and Subsequent Mechanosensing of Endothelial Cells Derived from Pluripotent Stem Cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Dapi (1:10,000) Roche 10236276 AlexaFluor 488 (1:1,000) Life Technologies A-11008; RRID: AB_143165 AlexaFluor 546 (1:1,000) Life Technologies A-10036; RRID: AB_2534012 AlexaFluor 647 (1:1,000) Life Technologies A-31573; RRID: AB_2536183 VECAD-PE (1:10) BD 560410; RRID: AB_1645502 CD31-PE (1:10) BD 555446; RRID: AB_395839 PDGFR-B (1:10) R&D FAB1263P; RRID: AB_2162793 VECAD (F-8) (1:100) Santa Cruz Sc-9989; RRID: AB_2077957 vWF (H-300) (1:100) Santa Cruz Sc-14014; RRID: AB_2241707 eNOS (1:100) BD 610297; RRID: AB_397691 PECAM-1/CD31 (1:100) Dako MO823; RRID: AB_2114471 Acetylated alpha-tubulin (1:100) Santa Cruz Sc-23950; RRID: AB_628409 SM22a (1:100) Ab Cam Ab 14106; RRID: AB_443021 HDAC6(D2E5) (1:1000) CST 7558S; RRID: AB_10891804 Acetylated alpha-tubulin (D20G3) CST 5335S; RRID: AB_10544694 GAPDH-HRP (1:20,000) Proteintech HRP-60004 Anti-rabbit IgG, HRP-linked antibody (1:3000) CST 7074S; RRID: AB_2099233 Chemicals, Peptides, and Recombinant Proteins Recombinant Human FGF basic (146 aa) Protein, CF R&D Systems 233-FB/CF Recombinant Human VEGF165 Protein, CF R&D Systems 293-VE-050 EGM-2 (ECFC media) Lonza CC-3162 EC Growth Medium 2 PromoCell C-22111 Medium 199 (10X) Thermo Fisher Scientific 11825015 Medium 199, no phenol red Thermo Fisher Scientific 11043023 Tubastatin A Santa Cruz Biotechnology sc-364640 MACs Separation Column Miltenyi Biotec 130042201 Anti-PE MicroBeads Miltenyi Biotec 130-048-801 CHIR99021 STEMCELL Technologies 720542-10mg SB-431542 R&D Systems 1614/10 Y-27632 (Dihydrochloride) STEMCELL Technologies 72304 ES DMEM/F12 GlobalStem GSM1102 Hyclone FBS Hyclone SH30071.03 Essential 8 Medium kit Thermo Fisher Scientific A1517001 Essential 6 Medium Thermo Fisher Scientific A1516401 Corning Collagen IV mouse, 1mg Corning 354233 Collagen I, High Concentration, Rat Tail, 100mg Corning 354249 Criterion precast Tris-HCL, gel 4-20% 18w Criterion 3450033 RIPA buffer Thermo Fisher Scientific 89900 Halt Protease and phosphotase inhibitor cocktail (100X) Thermo Fisher Scientific 78440 Super signal west pico chemiluminescent Thermo Fisher Scientific 34087 Pierce Modified Lowry Protein Assay Kit Thermo Fisher Scientific 23240 Pierce BCA Protein Assay kit Thermo Fisher Scientific 23227 Pageruler plus prestained protein ladder Thermo Fisher Scientific 26619 (Continued on next page) Cell Reports 24, 895–908.e1–e6, July 24, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER iblot transfer stack nitrocellulose regular Thermo Fisher Scientific IB23001 20X Bolt MOPS SDS Running Buffer Thermo Fisher Scientific B0001 NE-PER Nuclear and Cytoplasmic Extraction Reagents Thermo Fisher Scientific 78835 MagicMark XP Western protein standard Thermo Fisher Scientific LC5603 iBlot 2 Transfer Stacks, PVDF, regular size Thermo Fisher Scientific IB24001 Critical Commercial Assays Trizol reagent Thermo Fisher Scientific 15596018 M-MLV Reverse Transcriptase Promega M1701 RNaseOUT Thermo Fisher Scientific 10777019 RT PCR master mix Thermo Fisher Scientific 4369016 Deposited Data hiPSC-EC cDNA microarray This Study GEO: GSE115870 Experimental Models: Cell Lines HUVEC single donor Promocell C-12200 HUAEC Promocell C-12202 Endothelial Colony Forming Cells (ECFCs) STAR Methods N/A iPSCs and Derivatives STAR Methods N/A Irradiated Mouse Embryonic Fibroblasts R&D Systems PSC001 Oligonucleotides Random primers Promega C1181 TaqMan Gene Arrays, see Table S2 Thermo Fisher Scientific N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ MATLAB MathWorks https://www.mathworks.com/products/ matlab.html Imaris BITPLANE http://www.bitplane.com/imaris-for- cell-biologists GraphPad GraphPad Software https://www.graphpad.com/scientific- software/prism/ Illustrator Adobe https://www.adobe.com

    Nitric Oxide Assay:

    Article Title: Stem cell-derived vessels-on-chip for cardiovascular disease modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies VE-Cadherin, rabbit Cell Signaling RRID: AB_2077970 PECAM-1, rabbit Thermo Fisher Scientific RRID: AB_10981955 DLL4, rabbit Cell Signaling RRID: AB_2800263 ARP3, mouse Sigma Aldrich RRID: AB_476749 KLF4, rabbit Thermo Fisher Scientific RRID: AB_2898967 Claudin5, Thermo Fisher Scientific RRID: AB_2809891 Angiopoietin2 Thermo Fisher Scientific RRID: AB_2544773 PECAM-1, mouse Cell Signaling RRID: AB_2160882 Alexa Fluor 555, donkey anti-rabbit Thermo Fisher Scientific RRID: AB_162543 Alexa Fluor 488, donkey anti-mouse Thermo Fisher Scientific RRID: AB_141607 Alexa Fluor 647, goat anti-mouse Thermo Fisher Scientific RRID: AB_2535809 CD31-FITC BD Cat#555445; RRID AB_395838 CD140b-PE BD Cat#558821; RRID:AB_397132 Chemicals, recombinant proteins FITC-dextran 2000 kDa Sigma Aldrich FD2000S DAPI Sigma Aldrich D9542 Live/Dead Viability/Toxicity Kit Thermo Fisher Scientific L3224 Collagenase P Roche 11213857001 oxLDL Thermo Fisher Scientific L34357 Dil-oxLDL Thermo Fisher Scientific L34358 BODIPY Thermo Fisher Scientific D3922 Phalloidin-Atto-647 Abcam ab176759 Hoechst33342 Thermo Fisher Scientific 62249 TBHP abcam ab113851 TY52156 Sigma Aldrich 5330620001 Pro3dure GR-10 resin Litholabs HX10031 VEGFA Peprotech 100-20-250 FGF2 Miltenyi Biotec 130-093-838 CHIR99021 Axon Medchem BV 1385 BMP4 PeproTech 120-05ET-10 Forskolin Abcam Ab120058 Critical commercial assays Fluorometric Nitric Oxide Assay Kit Sigma Aldrich 482655-1KIT Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics 1000269 Chromium Next GEM Chip G Single Cell Kit 10x Genomics 1000127 NovaSeq SP flow cell Illumina PreOmics’ iST Kit Preomics GmbH P.O.00001 Green fluorescent CellROX Sigma Aldrich C10444 Experimental models: Cell lines HiPSC HMGUi001-A Software and algorithms Python (version 3.9.12) python https://www.python.org/ Jupyter lab (version 3.4.8) jupyter https://jupyter.org/ (Continued on next page) 16 Cell Reports 43, 114008, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Scrublet Wolock et al.59 https://github.com/swolock/scrublet Scanpy (version 1.9.1) Scverse project https://github.com/scverse/scanpy scVelo (version 0.2.5) Theis lab https://github.com/theislab/scvelo All source code files used within this paper are published on Github Meier lab GitHub: https://github.com/MeierLabMiBioEng/ StemCell-derivedVessel-on-chip Deposited data All scRNA seq data sets are deposited at GEO.

    Single Cell:

    Article Title: Stem cell-derived vessels-on-chip for cardiovascular disease modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies VE-Cadherin, rabbit Cell Signaling RRID: AB_2077970 PECAM-1, rabbit Thermo Fisher Scientific RRID: AB_10981955 DLL4, rabbit Cell Signaling RRID: AB_2800263 ARP3, mouse Sigma Aldrich RRID: AB_476749 KLF4, rabbit Thermo Fisher Scientific RRID: AB_2898967 Claudin5, Thermo Fisher Scientific RRID: AB_2809891 Angiopoietin2 Thermo Fisher Scientific RRID: AB_2544773 PECAM-1, mouse Cell Signaling RRID: AB_2160882 Alexa Fluor 555, donkey anti-rabbit Thermo Fisher Scientific RRID: AB_162543 Alexa Fluor 488, donkey anti-mouse Thermo Fisher Scientific RRID: AB_141607 Alexa Fluor 647, goat anti-mouse Thermo Fisher Scientific RRID: AB_2535809 CD31-FITC BD Cat#555445; RRID AB_395838 CD140b-PE BD Cat#558821; RRID:AB_397132 Chemicals, recombinant proteins FITC-dextran 2000 kDa Sigma Aldrich FD2000S DAPI Sigma Aldrich D9542 Live/Dead Viability/Toxicity Kit Thermo Fisher Scientific L3224 Collagenase P Roche 11213857001 oxLDL Thermo Fisher Scientific L34357 Dil-oxLDL Thermo Fisher Scientific L34358 BODIPY Thermo Fisher Scientific D3922 Phalloidin-Atto-647 Abcam ab176759 Hoechst33342 Thermo Fisher Scientific 62249 TBHP abcam ab113851 TY52156 Sigma Aldrich 5330620001 Pro3dure GR-10 resin Litholabs HX10031 VEGFA Peprotech 100-20-250 FGF2 Miltenyi Biotec 130-093-838 CHIR99021 Axon Medchem BV 1385 BMP4 PeproTech 120-05ET-10 Forskolin Abcam Ab120058 Critical commercial assays Fluorometric Nitric Oxide Assay Kit Sigma Aldrich 482655-1KIT Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics 1000269 Chromium Next GEM Chip G Single Cell Kit 10x Genomics 1000127 NovaSeq SP flow cell Illumina PreOmics’ iST Kit Preomics GmbH P.O.00001 Green fluorescent CellROX Sigma Aldrich C10444 Experimental models: Cell lines HiPSC HMGUi001-A Software and algorithms Python (version 3.9.12) python https://www.python.org/ Jupyter lab (version 3.4.8) jupyter https://jupyter.org/ (Continued on next page) 16 Cell Reports 43, 114008, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Scrublet Wolock et al.59 https://github.com/swolock/scrublet Scanpy (version 1.9.1) Scverse project https://github.com/scverse/scanpy scVelo (version 0.2.5) Theis lab https://github.com/theislab/scvelo All source code files used within this paper are published on Github Meier lab GitHub: https://github.com/MeierLabMiBioEng/ StemCell-derivedVessel-on-chip Deposited data All scRNA seq data sets are deposited at GEO.

    Software:

    Article Title: Stem cell-derived vessels-on-chip for cardiovascular disease modeling.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies VE-Cadherin, rabbit Cell Signaling RRID: AB_2077970 PECAM-1, rabbit Thermo Fisher Scientific RRID: AB_10981955 DLL4, rabbit Cell Signaling RRID: AB_2800263 ARP3, mouse Sigma Aldrich RRID: AB_476749 KLF4, rabbit Thermo Fisher Scientific RRID: AB_2898967 Claudin5, Thermo Fisher Scientific RRID: AB_2809891 Angiopoietin2 Thermo Fisher Scientific RRID: AB_2544773 PECAM-1, mouse Cell Signaling RRID: AB_2160882 Alexa Fluor 555, donkey anti-rabbit Thermo Fisher Scientific RRID: AB_162543 Alexa Fluor 488, donkey anti-mouse Thermo Fisher Scientific RRID: AB_141607 Alexa Fluor 647, goat anti-mouse Thermo Fisher Scientific RRID: AB_2535809 CD31-FITC BD Cat#555445; RRID AB_395838 CD140b-PE BD Cat#558821; RRID:AB_397132 Chemicals, recombinant proteins FITC-dextran 2000 kDa Sigma Aldrich FD2000S DAPI Sigma Aldrich D9542 Live/Dead Viability/Toxicity Kit Thermo Fisher Scientific L3224 Collagenase P Roche 11213857001 oxLDL Thermo Fisher Scientific L34357 Dil-oxLDL Thermo Fisher Scientific L34358 BODIPY Thermo Fisher Scientific D3922 Phalloidin-Atto-647 Abcam ab176759 Hoechst33342 Thermo Fisher Scientific 62249 TBHP abcam ab113851 TY52156 Sigma Aldrich 5330620001 Pro3dure GR-10 resin Litholabs HX10031 VEGFA Peprotech 100-20-250 FGF2 Miltenyi Biotec 130-093-838 CHIR99021 Axon Medchem BV 1385 BMP4 PeproTech 120-05ET-10 Forskolin Abcam Ab120058 Critical commercial assays Fluorometric Nitric Oxide Assay Kit Sigma Aldrich 482655-1KIT Chromium Next GEM Single Cell 30 Kit v3.1 10x Genomics 1000269 Chromium Next GEM Chip G Single Cell Kit 10x Genomics 1000127 NovaSeq SP flow cell Illumina PreOmics’ iST Kit Preomics GmbH P.O.00001 Green fluorescent CellROX Sigma Aldrich C10444 Experimental models: Cell lines HiPSC HMGUi001-A Software and algorithms Python (version 3.9.12) python https://www.python.org/ Jupyter lab (version 3.4.8) jupyter https://jupyter.org/ (Continued on next page) 16 Cell Reports 43, 114008, April 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Scrublet Wolock et al.59 https://github.com/swolock/scrublet Scanpy (version 1.9.1) Scverse project https://github.com/scverse/scanpy scVelo (version 0.2.5) Theis lab https://github.com/theislab/scvelo All source code files used within this paper are published on Github Meier lab GitHub: https://github.com/MeierLabMiBioEng/ StemCell-derivedVessel-on-chip Deposited data All scRNA seq data sets are deposited at GEO.

    other:

    Article Title: SMAD6 transduces endothelial cell flow responses required for blood vessel homeostasis
    Article Snippet: Rabbit monoclonal anti-VE-cadherin Cell Signaling D87F2;2077969 Mouse monoclonal anti-PECAM1 Cell Signaling 3528S;2160882 Rabbit monoclonal anti-GM130 Abcam EP892Y;52649 Mouse monoclonal anti-TUBGCP2 Abcam GCP2-01;140225 Mouse monoclonal anti-g tubulin Thermo Fisher T5326;2211251 Sheep polyclonal anti-BRDU Abcam ab1893;302659 Rabbit polyclonal anti-Ki67 Abcam ab15580;443209 Goat anti-Rabbit 488 Life Tech A-11034 Goat anti-Mouse 584 Life Tech A-11005 Donkey anti-Sheep 594 Life Tech A-11016

    Article Title: TRPV2 channels facilitate pulmonary endothelial barrier recovery after ROS-induced permeability
    Article Snippet: Table S1: HPMEC donor information (Promocell) Donor ID (Lot #) Catalogue # Age Sex Ethnicity Disease Status 467Z025.1 C-12281 61 Female Caucasian Healthy 463Z013.1 C-12281 57 Female Caucasian Healthy 489Z006.1 C-12281 51 Male Caucasian Healthy 489Z005 C-12281 52 Female Caucasian Healthy Table S2: IC50 values for TRP and ADAM inhibitors Compound Target Expression System Assay Type IC50 Econazole TRPM2 HEK293, hTRPM2 Electrophysiology < 3 μM [34] JNJ-28583113 TRPM2 HEK293, hTRPM2 Electrophysiology 126 nM [35] Tranilast TRPV2 HEK293T, hTRPV2 Fluorometric Assay 2.3 μM [31] Valdecoxib TRPV2 HEK293, rtTRPV2 Fluorometric Assay 9 μM [32] GI254023X ADAM10 COS-7, hADAM10 Enzymatic Cleavage Assay 5.3 nM [30] GSK2193874 TRPV4 HEK293T, hTRPV4 Fluorometric Assay 2 nM [33] Table S3: Antibodies used for Western blotting and immunocytochemistry Primary Antibodies Supplier Cat. # / RRID Dilution VE-Cadherin (rb pAb) Cell Signaling 2158 / AB_2077970 WB: 1:1,000; ICC: 1:400 Phospho-VE-cadherin (Tyr731) (rb pAb) ThermoFisher Scientific 44-1145G / AB_2533584 WB: 1:1,000 N-Cadherin (Mo pAb) BD biosciences 610920 / AB_2077527 WB: 1:1,000; ICC: 1:400 TRPM2 (rb pAb) Bethyl A300-414A / AB_2208495 WB: 1:300 TRPV2 (rb pAb) Abcam Ab272862 / AB_2892218 WB: 1:300 Β-actin-HRP (mo pAb) Merck A3854 / AB_262011 WB: 1:10,000 Secondary Antibodies Supplier Cat. # / RRID Dilution Rabbit IgG-POX Merck A6154 / AB_258284 WB: 1:10,000 Mouse IgG-HRP Cell Signaling 7076 / AB_330924 WB: 1:10,000 Rabbit Alexa Fluor 488 ThermoFisher Scientific A32731 / AB_2633280 ICC: 1:250 Mouse Alexa Fluor 594 ThermoFisher Scientific A-11005 / AB_2534073 ICC: 1:250 Table S4: DNA-sequences of qRT-PCR primer pairs Gene Forward Primer Reverse Primer TRPC1 GAG AGC ATT TGA ACT TAG TGC TGA TTA CAT TGC CGG GCT AGT TC TRPC4 GGT CAG ACT TGA ACA GGC AAG GTT TAA TTT CTC CCC ATA TGA AGC TRPV2 CTG ACC GTT GGC ACT AAG C CTC CCA TGA AGC CCA GTT C TRPV4 GGA CAC GTG TGG GGA AGA CAC AGC CAG CAT CTC GTG TRPM2 GCC TCA GCT GCT TCG G CTT CAC CAC CAG CAC TTC CA TRPM7 AGA CTC GGC TTC TGC TGC TA TCC AGG ATT TCT GGG ACA TTC TC Ct rl 30 0 μ M H 2 O 2 0 50 100 LD H re le as e (% , r el . t o Tr ito nX1 00 ) ns A Fig. S1.

    Reverse Transcription:

    Article Title: APOL1 risk variants in individuals of African genetic ancestry drive endothelial cell defects that exacerbate sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Caspase-1 Adipogen Cat#AG-20B-0042-C100; RRID: AB_2755041 Anti-GAPDH CST Cat#2118; RRID: AB_561053 Anti-GSMD Abcam Cat#ab209845; RRID: AB_2783550 Anti-APOL1 Proteintech Cat#66124-1-Ig; RRID: AB_2881523 Anti-APOL1 Genentech Rabmab 5.17D12 Anti-GFP Abcam Cat#AB6673; RRID: AB_305643 Anti-NLRP3 Adipogen Cat#AG-20B-0014C100; RRID: AB_2885199 Anti-LC3II CST Cat#2775; RRID: AB_915950 Anti-CD31 Abcam Cat#ab24590; RRID: AB_448167 Anti-Icam1 Abcam Cat#ab179707; RRID: AB_2814769 Anti-Vcam1 Abcam Cat#ab134047; RRID: AB_2721053 Anti-Caveolin-1 CST Cat#3267; RRID: AB_2275453 Anti-Enos Abcam Cat#ab5589; RRID: AB_304967 Anti-Hsp60 CST Cat#12165; RRID: AB_2636980 Anti-Cox4 R&D Systems Cat#MAB6980; RRID: AB_10973832 Anti-STING CST Cat#13647s; RRID: AB_2732796 Anti-phosphorylated STING CST Cat#19781s; RRID: AB_2737062 Anti-cGAS CST Cat#31659S; RRID: AB_2799008 Anti-TBK1 CST Cat#3504S; RRID: AB_2255663 Anti-phosphorylated TBK1 CST Cat5483; RRID: AB_10693472 Anti-IRF3 CST Cat11904T; RRID: AB_2722521 Anti-phosphorylated IFR3 CST Cat#37829; RRID: AB_2799121 Anti-P65 CST Cat#8242; RRID: AB_10859369 Anti-Phospho-NF-kB p65 CST Cat#3033; RRID: AB_331284 Monoclonal Anti-b-Actin Peroxidase antibody Sigma Aldrich Cat#A3854; RRID: AB_262011 Anti-VE-cadherin Santa Cruz Cat#sc-6458; RRID: AB_2077955 OXPHOS antibody cocktail Abcam Cat#ab110413; RRID: AB_2629281 Anti-p62 CST Cat#5114; RRID: AB_10624872 Donkey anti-Rabbit IgG (H+L) Alexa Fluor 555 Invitrogen Cat#A31572; RRID: AB_162543 Chicken anti-Mouse IgG (H+L), Alexa Fluor 488 Invitrogen Cat#21200; RRID: AB_2535786 Chemicals, peptides, and recombinant proteins LPS (Escherichia. coli O26:B6) Sigma-Aldrich Cat#L8274 VX765 Cayman Cat#CAYM-28825-50 Disulfiram Cayman Cat#97-77-8 C176 Bio Vision Cat#B2341 Evans blue dye Sigma Cat#E2129 CD31 MicroBeads, mouse miltenyi biotec Cat#130-097-418 TET system approved FBS Clontech Cat#631106 Microvascular EBM-2 Lonza Cat#cc-3162 Hydrogen peroxide solution 30% Sigma H1009-500ML Trizol Invitrogen Cat#15596018 cDNA Reverse Transcription Kit Applied Biosystems Cat#4368813 Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367659 RIPA buffer Cell signaling Cat#9806 (Continued on next page) e1 Immunity 54, 2632–2649.e1–e6, November 9, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease cocktail Roche Cat#11836153001 BCA protein assay Thermo Scientific Cat#23225 Western Blotting Substrate Pierce Cat#32106 Lipofectamine 3000 reagents Thermo Fisher Scientific Cat#11668019 LysoTracker Blue DND-22 Thermo Fisher Scientific Cat#L7525 ECIS Cultureware Disposable Electrode Arrays Applied BioPhysics 8W10E+ (8 Well PET) l-cysteine Sigma Cat#C7352-25G Gelatin solution Sigma Cat#G1393-100ML JC-1 Invitrogen Cat#T3168 Digitonin EMD Millipore Cat#11024-24-1 DNeasy Blood and Tissue kit QIAGEN Cat#69506 COX8-EGFP-mCherry plasmid Addgene Cat#78520 Hs-APOL1 -C probe bio-techne Cat#459791 APOL1-No-XMm-C2 bio-techne Cat#459798-C2 Mm-Nlrp3 bio-techne Cat#439571 Hs-PECAM1-O1 bio-techne Cat#487381 Critical commercial assays Mouse albumin specific ELISA Bethyl Laboratories Cat#E99-134 Creatinine reagent Diazyme Cat#DZ072B RNAscope 2.5 HD Duplex Detection Kit bio-techne Cat#322436 Multi Tissue dissociation kit 1 Miltenyi Cat#130-110-2011 APOL1 ELISA Kit Proteintech Cat#KE00047 Mouse IL-1 beta ELISA Kit R&D Systems MLB00C Mouse TNF-alpha R&D Systems MTA00B Il-10 ELISA Kit R&D Systems Cat#M1000B Angpt2 ELISA Kit R&D Systems Cat#MANG20 Myeloperoxidase assay kit Sigma Cat#MAK068-1KT Expermental models: Organisms/strains Cdh5 tTA Jackson Laboratory Stock#013585 GT26.rtTA Jackson Laboratory Stock#5670 Nlrp3KO Jackson Laboratory Stock#21302 STING KO Jackson Laboratory Stock#025805 Caspase1/11 KO Jackson Laboratory Stock#16621 Gsdmd KO Jackson Laboratory Stock#032410 Alb-Cre Jackson Laboratory Stock#003574

    SYBR Green Assay:

    Article Title: APOL1 risk variants in individuals of African genetic ancestry drive endothelial cell defects that exacerbate sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Caspase-1 Adipogen Cat#AG-20B-0042-C100; RRID: AB_2755041 Anti-GAPDH CST Cat#2118; RRID: AB_561053 Anti-GSMD Abcam Cat#ab209845; RRID: AB_2783550 Anti-APOL1 Proteintech Cat#66124-1-Ig; RRID: AB_2881523 Anti-APOL1 Genentech Rabmab 5.17D12 Anti-GFP Abcam Cat#AB6673; RRID: AB_305643 Anti-NLRP3 Adipogen Cat#AG-20B-0014C100; RRID: AB_2885199 Anti-LC3II CST Cat#2775; RRID: AB_915950 Anti-CD31 Abcam Cat#ab24590; RRID: AB_448167 Anti-Icam1 Abcam Cat#ab179707; RRID: AB_2814769 Anti-Vcam1 Abcam Cat#ab134047; RRID: AB_2721053 Anti-Caveolin-1 CST Cat#3267; RRID: AB_2275453 Anti-Enos Abcam Cat#ab5589; RRID: AB_304967 Anti-Hsp60 CST Cat#12165; RRID: AB_2636980 Anti-Cox4 R&D Systems Cat#MAB6980; RRID: AB_10973832 Anti-STING CST Cat#13647s; RRID: AB_2732796 Anti-phosphorylated STING CST Cat#19781s; RRID: AB_2737062 Anti-cGAS CST Cat#31659S; RRID: AB_2799008 Anti-TBK1 CST Cat#3504S; RRID: AB_2255663 Anti-phosphorylated TBK1 CST Cat5483; RRID: AB_10693472 Anti-IRF3 CST Cat11904T; RRID: AB_2722521 Anti-phosphorylated IFR3 CST Cat#37829; RRID: AB_2799121 Anti-P65 CST Cat#8242; RRID: AB_10859369 Anti-Phospho-NF-kB p65 CST Cat#3033; RRID: AB_331284 Monoclonal Anti-b-Actin Peroxidase antibody Sigma Aldrich Cat#A3854; RRID: AB_262011 Anti-VE-cadherin Santa Cruz Cat#sc-6458; RRID: AB_2077955 OXPHOS antibody cocktail Abcam Cat#ab110413; RRID: AB_2629281 Anti-p62 CST Cat#5114; RRID: AB_10624872 Donkey anti-Rabbit IgG (H+L) Alexa Fluor 555 Invitrogen Cat#A31572; RRID: AB_162543 Chicken anti-Mouse IgG (H+L), Alexa Fluor 488 Invitrogen Cat#21200; RRID: AB_2535786 Chemicals, peptides, and recombinant proteins LPS (Escherichia. coli O26:B6) Sigma-Aldrich Cat#L8274 VX765 Cayman Cat#CAYM-28825-50 Disulfiram Cayman Cat#97-77-8 C176 Bio Vision Cat#B2341 Evans blue dye Sigma Cat#E2129 CD31 MicroBeads, mouse miltenyi biotec Cat#130-097-418 TET system approved FBS Clontech Cat#631106 Microvascular EBM-2 Lonza Cat#cc-3162 Hydrogen peroxide solution 30% Sigma H1009-500ML Trizol Invitrogen Cat#15596018 cDNA Reverse Transcription Kit Applied Biosystems Cat#4368813 Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367659 RIPA buffer Cell signaling Cat#9806 (Continued on next page) e1 Immunity 54, 2632–2649.e1–e6, November 9, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease cocktail Roche Cat#11836153001 BCA protein assay Thermo Scientific Cat#23225 Western Blotting Substrate Pierce Cat#32106 Lipofectamine 3000 reagents Thermo Fisher Scientific Cat#11668019 LysoTracker Blue DND-22 Thermo Fisher Scientific Cat#L7525 ECIS Cultureware Disposable Electrode Arrays Applied BioPhysics 8W10E+ (8 Well PET) l-cysteine Sigma Cat#C7352-25G Gelatin solution Sigma Cat#G1393-100ML JC-1 Invitrogen Cat#T3168 Digitonin EMD Millipore Cat#11024-24-1 DNeasy Blood and Tissue kit QIAGEN Cat#69506 COX8-EGFP-mCherry plasmid Addgene Cat#78520 Hs-APOL1 -C probe bio-techne Cat#459791 APOL1-No-XMm-C2 bio-techne Cat#459798-C2 Mm-Nlrp3 bio-techne Cat#439571 Hs-PECAM1-O1 bio-techne Cat#487381 Critical commercial assays Mouse albumin specific ELISA Bethyl Laboratories Cat#E99-134 Creatinine reagent Diazyme Cat#DZ072B RNAscope 2.5 HD Duplex Detection Kit bio-techne Cat#322436 Multi Tissue dissociation kit 1 Miltenyi Cat#130-110-2011 APOL1 ELISA Kit Proteintech Cat#KE00047 Mouse IL-1 beta ELISA Kit R&D Systems MLB00C Mouse TNF-alpha R&D Systems MTA00B Il-10 ELISA Kit R&D Systems Cat#M1000B Angpt2 ELISA Kit R&D Systems Cat#MANG20 Myeloperoxidase assay kit Sigma Cat#MAK068-1KT Expermental models: Organisms/strains Cdh5 tTA Jackson Laboratory Stock#013585 GT26.rtTA Jackson Laboratory Stock#5670 Nlrp3KO Jackson Laboratory Stock#21302 STING KO Jackson Laboratory Stock#025805 Caspase1/11 KO Jackson Laboratory Stock#16621 Gsdmd KO Jackson Laboratory Stock#032410 Alb-Cre Jackson Laboratory Stock#003574

    Polymerase Chain Reaction:

    Article Title: APOL1 risk variants in individuals of African genetic ancestry drive endothelial cell defects that exacerbate sepsis.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Caspase-1 Adipogen Cat#AG-20B-0042-C100; RRID: AB_2755041 Anti-GAPDH CST Cat#2118; RRID: AB_561053 Anti-GSMD Abcam Cat#ab209845; RRID: AB_2783550 Anti-APOL1 Proteintech Cat#66124-1-Ig; RRID: AB_2881523 Anti-APOL1 Genentech Rabmab 5.17D12 Anti-GFP Abcam Cat#AB6673; RRID: AB_305643 Anti-NLRP3 Adipogen Cat#AG-20B-0014C100; RRID: AB_2885199 Anti-LC3II CST Cat#2775; RRID: AB_915950 Anti-CD31 Abcam Cat#ab24590; RRID: AB_448167 Anti-Icam1 Abcam Cat#ab179707; RRID: AB_2814769 Anti-Vcam1 Abcam Cat#ab134047; RRID: AB_2721053 Anti-Caveolin-1 CST Cat#3267; RRID: AB_2275453 Anti-Enos Abcam Cat#ab5589; RRID: AB_304967 Anti-Hsp60 CST Cat#12165; RRID: AB_2636980 Anti-Cox4 R&D Systems Cat#MAB6980; RRID: AB_10973832 Anti-STING CST Cat#13647s; RRID: AB_2732796 Anti-phosphorylated STING CST Cat#19781s; RRID: AB_2737062 Anti-cGAS CST Cat#31659S; RRID: AB_2799008 Anti-TBK1 CST Cat#3504S; RRID: AB_2255663 Anti-phosphorylated TBK1 CST Cat5483; RRID: AB_10693472 Anti-IRF3 CST Cat11904T; RRID: AB_2722521 Anti-phosphorylated IFR3 CST Cat#37829; RRID: AB_2799121 Anti-P65 CST Cat#8242; RRID: AB_10859369 Anti-Phospho-NF-kB p65 CST Cat#3033; RRID: AB_331284 Monoclonal Anti-b-Actin Peroxidase antibody Sigma Aldrich Cat#A3854; RRID: AB_262011 Anti-VE-cadherin Santa Cruz Cat#sc-6458; RRID: AB_2077955 OXPHOS antibody cocktail Abcam Cat#ab110413; RRID: AB_2629281 Anti-p62 CST Cat#5114; RRID: AB_10624872 Donkey anti-Rabbit IgG (H+L) Alexa Fluor 555 Invitrogen Cat#A31572; RRID: AB_162543 Chicken anti-Mouse IgG (H+L), Alexa Fluor 488 Invitrogen Cat#21200; RRID: AB_2535786 Chemicals, peptides, and recombinant proteins LPS (Escherichia. coli O26:B6) Sigma-Aldrich Cat#L8274 VX765 Cayman Cat#CAYM-28825-50 Disulfiram Cayman Cat#97-77-8 C176 Bio Vision Cat#B2341 Evans blue dye Sigma Cat#E2129 CD31 MicroBeads, mouse miltenyi biotec Cat#130-097-418 TET system approved FBS Clontech Cat#631106 Microvascular EBM-2 Lonza Cat#cc-3162 Hydrogen peroxide solution 30% Sigma H1009-500ML Trizol Invitrogen Cat#15596018 cDNA Reverse Transcription Kit Applied Biosystems Cat#4368813 Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367659 RIPA buffer Cell signaling Cat#9806 (Continued on next page) e1 Immunity 54, 2632–2649.e1–e6, November 9, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protease cocktail Roche Cat#11836153001 BCA protein assay Thermo Scientific Cat#23225 Western Blotting Substrate Pierce Cat#32106 Lipofectamine 3000 reagents Thermo Fisher Scientific Cat#11668019 LysoTracker Blue DND-22 Thermo Fisher Scientific Cat#L7525 ECIS Cultureware Disposable Electrode Arrays Applied BioPhysics 8W10E+ (8 Well PET) l-cysteine Sigma Cat#C7352-25G Gelatin solution Sigma Cat#G1393-100ML JC-1 Invitrogen Cat#T3168 Digitonin EMD Millipore Cat#11024-24-1 DNeasy Blood and Tissue kit QIAGEN Cat#69506 COX8-EGFP-mCherry plasmid Addgene Cat#78520 Hs-APOL1 -C probe bio-techne Cat#459791 APOL1-No-XMm-C2 bio-techne Cat#459798-C2 Mm-Nlrp3 bio-techne Cat#439571 Hs-PECAM1-O1 bio-techne Cat#487381 Critical commercial assays Mouse albumin specific ELISA Bethyl Laboratories Cat#E99-134 Creatinine reagent Diazyme Cat#DZ072B RNAscope 2.5 HD Duplex Detection Kit bio-techne Cat#322436 Multi Tissue dissociation kit 1 Miltenyi Cat#130-110-2011 APOL1 ELISA Kit Proteintech Cat#KE00047 Mouse IL-1 beta ELISA Kit R&D Systems MLB00C Mouse TNF-alpha R&D Systems MTA00B Il-10 ELISA Kit R&D Systems Cat#M1000B Angpt2 ELISA Kit R&D Systems Cat#MANG20 Myeloperoxidase assay kit Sigma Cat#MAK068-1KT Expermental models: Organisms/strains Cdh5 tTA Jackson Laboratory Stock#013585 GT26.rtTA Jackson Laboratory Stock#5670 Nlrp3KO Jackson Laboratory Stock#21302 STING KO Jackson Laboratory Stock#025805 Caspase1/11 KO Jackson Laboratory Stock#16621 Gsdmd KO Jackson Laboratory Stock#032410 Alb-Cre Jackson Laboratory Stock#003574



    Similar Products

    93
    Cell Signaling Technology Inc ab 2077970 wb
    Ab 2077970 Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc12210324__mmc1-79-135-131
    Average 93 stars, based on 1 article reviews
    ab 2077970 wb - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc anti ve cadherin
    Anti Ve Cadherin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc11077004-44-0-8
    Average 93 stars, based on 1 article reviews
    anti ve cadherin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc rabbit monoclonal anti ve cadherin cell signaling d87f2
    Rabbit Monoclonal Anti Ve Cadherin Cell Signaling D87f2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc08206051__10456_2021_9777_MOESM1_ESM-91-0-3
    Average 93 stars, based on 1 article reviews
    rabbit monoclonal anti ve cadherin cell signaling d87f2 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc ve cadherin
    Ve Cadherin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/ppr0258460-221-27-29
    Average 93 stars, based on 1 article reviews
    ve cadherin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc d87f2 rrid ab 2077969
    KEY RESOURCES TABLE
    D87f2 Rrid Ab 2077969, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc06903908-4-8-4
    Average 93 stars, based on 1 article reviews
    d87f2 rrid ab 2077969 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc 2077969 mouse monoclonal anti ve cadherin bv6 enzo
    KEY RESOURCES TABLE
    2077969 Mouse Monoclonal Anti Ve Cadherin Bv6 Enzo, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc06903908-439-47-42
    Average 93 stars, based on 1 article reviews
    2077969 mouse monoclonal anti ve cadherin bv6 enzo - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc rabbit
    KEY RESOURCES TABLE
    Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/NO66+Rabbit+mAb/pmc05173267-283-24-35
    Average 93 stars, based on 1 article reviews
    rabbit - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Developmental biology

    Article Title: Developmental SMAD6 Loss Leads to Blood Vessel Hemorrhage and Disrupted Endothelial Cell Junctions

    doi: 10.1016/j.ydbio.2018.07.027

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Rabbit monoclonal anti-VE-cadherin , Cell Signaling , Cat# D87F2; RRID:AB_ 2077969.

    Techniques: Recombinant, Transfection

    KEY RESOURCES TABLE

    Journal: Developmental biology

    Article Title: Developmental SMAD6 Loss Leads to Blood Vessel Hemorrhage and Disrupted Endothelial Cell Junctions

    doi: 10.1016/j.ydbio.2018.07.027

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: All key resources used in experiments are listed in the . table ft1 table-wrap mode="anchored" t5 caption a7 Reagent or resource Source Identifier Antibodies Rat monoclonal anti-CD31 BD Pharmingen Cat# 553370; RRID:AB_394816 Rat monoclonal anti-CD31 BD Pharmingen Cat#550274; RRID:AB_393571 Rabbit monoclonal anti-VE-cadherin Cell Signaling Cat# D87F2; RRID:AB_ 2077969 Mouse monoclonal anti-VE-cadherin BV6 Enzo Cat# ALX-803-305-C100; RRID: AB Rabbit polyclonal anti-VE-cadherin Santa Cruz Cat# 28644; RRID:AB_ 2052810 Rabbit polyclonal anti-NG2 Millipore Cat# AB5320; RRID:AB_11213678 Monoclonal anti-actin, alpha-smooth-muscle-Cy3 Sigma-Aldrich Cat# C6198; RRID:AB_476856 Rabbit polyclonal anti-SMAD6 Abcam Cat# ab13727;RRID: AB_300605 Mouse monoclonal anti-GAPDH Cell Signaling Cat# 97166S Rabbit polyclonal anti-ZO-1 ThermoFisher Cat# 61-7300; RRID:AB_138452 Chemicals, Peptides, and Recombinant Proteins Recombinant human BMP6 R&D Systems Cat# 507-BP-020 X-gal Promega Cat# V394A Critical Commercial Assays Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat# L3000008 Experimental Models: Cell Lines Human Umbilical Vein Endothelial Cells Lonza Cat# C2519A Experimental Models: Organisms/Strains Mouse: Smad6 +/− Dr. Karen Lyons ( Estrada et al., 2011 )( Galvin et al., 2000 ) Mouse: Flt1 +/ LacZ Dr. Guo Hua Fong Oligonucleotides F primer for Smad6 +/+ mice: 5’- CCTTGCCATATCCTATGCTTGCG-3’ Eurofins N/A F primer for Smad6 −/− mice: 5’- GCTTCCTCGTGCTTTACGGTATC-3’ Eurofins N/A R primer for Smad6 mice: 5’- GCGCCGCACCGACTCACTGC -3’ Eurofins N/A F primer for m Smad6 retina RNA: 5’-AGCATTTTCTACGACCTACCTCA-3’ Eurofins N/A R primer for m Smad6 retina RNA: 5’-CCTTGATGGAGTAACCCGGTG-3’ Eurofins N/A F primer for m Pecam1 retina RNA: 5’-ATGACCCAGCAACATTCACA-3’ Eurofins N/A R primer for m Pecam1 retina RNA: 5’-CACAGAGCACCGAAGTACCA-3’ Eurofins N/A F primer for mGAPDH retina RNA: 5’-ACCACAGTCCATGCCATCAC-3’ Eurofins N/A R primer for mGAPDH retina RNA: 5’-CACCACCCTGTTGCTGTAGCC-3’ Eurofins N/A Non-targeting siRNA Life Technologies Cat# 4390847 SMAD6 siRNA s8410 Life Technologies Cat# 4392420 SMAD6siRNA s8411 Life Technologies Cat# 4392420 Other DRAQ7 Abcam Cat# ab109202 Isolectin-IB4 Alexa-Fluor 594 conjugate Thermo Fisher Cat# {"type":"entrez-nucleotide","attrs":{"text":"I21413","term_id":"1601767","term_text":"I21413"}} I21413 Alexa-Fluor 594 Phalloidin Invitrogen Cat# A12381 Open in a separate window KEY RESOURCES TABLE

    Techniques: Recombinant, Transfection