Review



anti no66  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    Santa Cruz Biotechnology anti no66
    Anti No66, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc04447221-103-73-74?v=Santa+Cruz+Biotechnology
    Average 85 stars, based on 2 article reviews
    anti no66 - by Bioz Stars, 2026-08
    85/100 stars

    Images



    Similar Products

    93
    Cell Signaling Technology Inc ab 2077970 wb
    Ab 2077970 Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc12210324__mmc1-79-135-131?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    ab 2077970 wb - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc anti ve cadherin
    Anti Ve Cadherin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc11077004-44-0-8?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    anti ve cadherin - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc rabbit monoclonal anti ve cadherin cell signaling d87f2
    Rabbit Monoclonal Anti Ve Cadherin Cell Signaling D87f2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc08206051__10456_2021_9777_MOESM1_ESM-91-0-3?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    rabbit monoclonal anti ve cadherin cell signaling d87f2 - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc ve cadherin
    Ve Cadherin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/ppr0258460-221-27-29?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    ve cadherin - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc d87f2 rrid ab 2077969
    KEY RESOURCES TABLE
    D87f2 Rrid Ab 2077969, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc06903908-4-8-4?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    d87f2 rrid ab 2077969 - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc 2077969 mouse monoclonal anti ve cadherin bv6 enzo
    KEY RESOURCES TABLE
    2077969 Mouse Monoclonal Anti Ve Cadherin Bv6 Enzo, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc06903908-439-47-42?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    2077969 mouse monoclonal anti ve cadherin bv6 enzo - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc rabbit
    KEY RESOURCES TABLE
    Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+no66/pmc05173267-283-24-35?v=Cell+Signaling+Technology+Inc
    Average 93 stars, based on 1 article reviews
    rabbit - by Bioz Stars, 2026-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Developmental biology

    Article Title: Developmental SMAD6 Loss Leads to Blood Vessel Hemorrhage and Disrupted Endothelial Cell Junctions

    doi: 10.1016/j.ydbio.2018.07.027

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Rabbit monoclonal anti-VE-cadherin , Cell Signaling , Cat# D87F2; RRID:AB_ 2077969.

    Techniques: Recombinant, Transfection

    KEY RESOURCES TABLE

    Journal: Developmental biology

    Article Title: Developmental SMAD6 Loss Leads to Blood Vessel Hemorrhage and Disrupted Endothelial Cell Junctions

    doi: 10.1016/j.ydbio.2018.07.027

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: All key resources used in experiments are listed in the . table ft1 table-wrap mode="anchored" t5 caption a7 Reagent or resource Source Identifier Antibodies Rat monoclonal anti-CD31 BD Pharmingen Cat# 553370; RRID:AB_394816 Rat monoclonal anti-CD31 BD Pharmingen Cat#550274; RRID:AB_393571 Rabbit monoclonal anti-VE-cadherin Cell Signaling Cat# D87F2; RRID:AB_ 2077969 Mouse monoclonal anti-VE-cadherin BV6 Enzo Cat# ALX-803-305-C100; RRID: AB Rabbit polyclonal anti-VE-cadherin Santa Cruz Cat# 28644; RRID:AB_ 2052810 Rabbit polyclonal anti-NG2 Millipore Cat# AB5320; RRID:AB_11213678 Monoclonal anti-actin, alpha-smooth-muscle-Cy3 Sigma-Aldrich Cat# C6198; RRID:AB_476856 Rabbit polyclonal anti-SMAD6 Abcam Cat# ab13727;RRID: AB_300605 Mouse monoclonal anti-GAPDH Cell Signaling Cat# 97166S Rabbit polyclonal anti-ZO-1 ThermoFisher Cat# 61-7300; RRID:AB_138452 Chemicals, Peptides, and Recombinant Proteins Recombinant human BMP6 R&D Systems Cat# 507-BP-020 X-gal Promega Cat# V394A Critical Commercial Assays Lipofectamine 3000 Transfection Reagent Thermo Fisher Cat# L3000008 Experimental Models: Cell Lines Human Umbilical Vein Endothelial Cells Lonza Cat# C2519A Experimental Models: Organisms/Strains Mouse: Smad6 +/− Dr. Karen Lyons ( Estrada et al., 2011 )( Galvin et al., 2000 ) Mouse: Flt1 +/ LacZ Dr. Guo Hua Fong Oligonucleotides F primer for Smad6 +/+ mice: 5’- CCTTGCCATATCCTATGCTTGCG-3’ Eurofins N/A F primer for Smad6 −/− mice: 5’- GCTTCCTCGTGCTTTACGGTATC-3’ Eurofins N/A R primer for Smad6 mice: 5’- GCGCCGCACCGACTCACTGC -3’ Eurofins N/A F primer for m Smad6 retina RNA: 5’-AGCATTTTCTACGACCTACCTCA-3’ Eurofins N/A R primer for m Smad6 retina RNA: 5’-CCTTGATGGAGTAACCCGGTG-3’ Eurofins N/A F primer for m Pecam1 retina RNA: 5’-ATGACCCAGCAACATTCACA-3’ Eurofins N/A R primer for m Pecam1 retina RNA: 5’-CACAGAGCACCGAAGTACCA-3’ Eurofins N/A F primer for mGAPDH retina RNA: 5’-ACCACAGTCCATGCCATCAC-3’ Eurofins N/A R primer for mGAPDH retina RNA: 5’-CACCACCCTGTTGCTGTAGCC-3’ Eurofins N/A Non-targeting siRNA Life Technologies Cat# 4390847 SMAD6 siRNA s8410 Life Technologies Cat# 4392420 SMAD6siRNA s8411 Life Technologies Cat# 4392420 Other DRAQ7 Abcam Cat# ab109202 Isolectin-IB4 Alexa-Fluor 594 conjugate Thermo Fisher Cat# {"type":"entrez-nucleotide","attrs":{"text":"I21413","term_id":"1601767","term_text":"I21413"}} I21413 Alexa-Fluor 594 Phalloidin Invitrogen Cat# A12381 Open in a separate window KEY RESOURCES TABLE

    Techniques: Recombinant, Transfection