α mannose binding lectin a (Hycult Biotech)

Hycult Biotech is a verified supplier

Hycult Biotech manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Hycult Biotech α mannose binding lectin a
α Mannose Binding Lectin A, supplied by Hycult Biotech, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/HM1025/MBL-A%2C+Mouse%2C+mAb+8G6/bio_rxiv__2020__08__27__270843-366-53-60
Average 91 stars, based on 5 article reviews

α mannose binding lectin a - by Bioz Stars, 2026-09

91/100 stars

Images

Binding Assay:

Article Title: A dissemination-prone morphotype enhances extrapulmonary organ entry by Cryptococcus neoformans
Article Snippet: Donkey anti-Rabbit IgG, AlexaFluor 405 , Abcam , Cat# ab175651. .. α-mannose binding lectin A, mAb 8G6 , Hycult , Cat# HM1035. .. Mouse anti-Rat IgG2a, FITC , ThermoFisher , Cat# 11-4817-82.

Article Title: A dissemination-prone morphotype enhances extrapulmonary organ entry by Cryptococcus neoformans.
Article Snippet: To estimate fungal microbial associated molecular pattern exposure, cells were stained at room temperature with 5 mg/mL fluorescein-conjugated wheat-germ agglutinin (WGA, Vector Laboratories catalog no. FL-1021) for 15 minutes to detect exposed chitin or 50 mg/mL fluorescein-conjugated concanavalin A (ConA, Vector Laboratories catalog no. FL-1001) for 5minutes to detect exposed mannose. .. To estimate the percentage of cells bound by soluble host factors, we used the following antibodies: a-complement C3 (primary: mAb 11H9, ThermoFisher catalog no. MA1-40046; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11-4817-82), a-surfactant protein D (primary: polyclonal, Abcam catalog no. ab203309; secondary: Donkey anti-Rabbit IgG, AlexaFluor 405, Abcam catalog no. ab175651), a-mannose binding lectin A (primary: mAb 8G6, Hycult catalog no. HM1035; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11-4817-82), a-mannose binding lectin C (primary:mAb 14D12, Abcam catalog no. ab106046; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11-4817-82), a-IgM (mAb II/41, FITC, BD Biosciences catalog no. 553437), a-IgA (mAb 11-44-2, FITC, SouthernBiotech catalog no. 1165-02). ..

Article Title: A dissemination-prone morphotype enhances extrapulmonary organ entry by Cryptococcus neoformans.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies a-complement C3: mAb 11H9 ThermoFisher Cat# MA1-40046; RRID: AB_1073809 Mouse anti-Rat IgG2a, FITC ThermoFisher Cat# 11-4817-82; RRID: AB_11042292 a-surfactant protein D, polyclonal Abcam Cat# ab203309; RRID: unavailable Donkey anti-Rabbit IgG, AlexaFluor 405 Abcam Cat# ab175651; RRID: unavailable a-mannose binding lectin A, mAb 8G6 Hycult Cat# HM1035; RRID: AB_10130941 Mouse anti-Rat IgG2a, FITC ThermoFisher Cat# 11-4817-82; RRID: AB_11042292 a-mannose binding lectin C, mAb 14D12 Abcam Cat# ab106046; RRID: AB_10861619 a-IgM mAb II/41, FITC BD Biosciences Cat# 553437; RRID: AB_394857 a-IgA mAb 11-44-2, FITC SouthernBiotech Cat# 1165-02; RRID: unavailable anti-Ly6G clone 1A8 BioXCell Cat# BP0075-1; RRID: unavailable anti-CD45-efluor450 eBiosciences Cat# 48-0451-82; RRID: unavailable anti-CD11b-APC eBiosciences Cat# 17-0112-82; RRID: unavailable anti-Ly6G-FITC eBiosciences Cat# 11-5931-82; RRID: unavailable Mouse anti-GPIba antibody Emfret Cat# R300; RRID: AB_2721041 Fluorescein-conjugated concanvalin A Vector Laboratories Cat# FL-1001; RRID: AB_2336348 Fluorescein-conjugated wheat germ agglutinin Vector Laboratories Cat# FL-1021; RRID: AB_2336866 Bacterial and virus strains C. neoformans KN99a pho4::NAT #1 This manuscript C. neoformans KN99a pho4::NAT #2 This manuscript C. neoformans KN99a H2B-mCherry NAT+ Gift from Alexander Idnurm Verma (2014) C. neoformans KN99a Fungal Genetics Stock Center Cat# 10369 C. neoformans Bt63a Heitman lab NCBI:txid1295841 C. neoformans 52D ATCC Cat# 24067 C. deuterogattii R265 ATCC Cat# MYA4093 C. gattii WM276 ATCC Cat# MYA-4071 Chemicals, peptides, and recombinant proteins fluorescein-conjugated concanavalin A Vector Laboratories Cat# FL-1001 fluorescein-conjugated wheat-germ agglutinin Vector Laboratories Cat# FL-1021 Clodronate liposomes Liposoma BV Cat# C-010 Control liposomes Liposoma BV Cat# P-010 TRIzol ThermoFisher Scientific Cat# 15596026 Recombinant Qsp1 Peptide 2.0 Scrambled Qsp1 Peptide 2.0 Control liposomes Liposoma BV Cat# P-010 Pigeon guano Michael Shapiro, University of Utah Green fluorescent polystyrene microspheres, 6 mm Polysciences, Inc. Cat# 17156-2 Green fluorescent polystyrene microspheres, 25 mm Polysciences, Inc. Cat# 18241-2 India ink Higgins Cat# 44201 UDP-glucose Sigma Aldrich Cat# 670120 UDP-galactose Sigma Aldrich Cat# 670111-M UDP-glucuronic acid Sigma Aldrich Cat# U5625 (Continued on next page) Cell Host & Microbe 30, 1382–1400.e1–e8, October 12, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER UDP-GlcNAc Sigma Aldrich Cat# 670107 Sabouraud’s dextrose agar Difco Cat# 238230 Yeast Nitrogen Base without amino acids Difco Cat# 291940 10% fetal calf serum GenClone Cat# 25-550 RPMI 1640 GenClone Cat# 25-506 Dulbecco’s Modified Eagle Medium GenClone Cat# 25-500 DAPI Sigma Aldrich Cat# 28718-90-3 Percoll GE Healthcare Cat# 17-0891-01 benomyl Agilent Cat# PST-1245 Direct Yellow 96 AK Scientific Cat# 61725-08-4 Accutase Corning Cat# 25-058-CI Trypan blue HyClone Cat# SV30084.01 Accutase Corning Cat# 25-058-CI mannan Sigma Aldrich Cat# M7504 b-glucan Millipore Sigma Cat# 1048288 N-acetyl glucosamine Vector Laboratories Cat# S-9002 Polyinosinic acid (Poly(I)) Sigma Aldrich Cat# 26936-41-1 Dexdomitor Zoetis, Inc Cat# 122692-5 Zetamine VetOne Cat# 13985-584-10 Antisedan Zoetis, Inc Cat# 87219-02296-2 Critical commercial assays Phosphate colorimetric kit Sigma Aldrich Cat# MAK030-1KT NEBNext Ultra II Directional RNA Library Prep with rRNA Depletion Kit New England BioLabs Cat# E7760 Qiagen RNeasy kit Qiagen Cat# 74104 0.5 mm zirconium beads Biospec Products Cat# 11079105z 1 mm zirconium beads Biospec Products Cat# 11079110z Deposited data RNA-seq dataset NCBI-GEO https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GSE152784 Experimental models: Organisms/strains Mice: C57Bl/6NJ Jackson labs RRID:IMSR_JAX:005304 Oligonucleotides pho4KO F: 5’ AAAACGGCTGAAGGCTCGTTCT3’ This manuscript pho4KO R: CTTCTGCAAGGTGAAGTTCACG This manuscript pho4KO ORF.F: 5’CCATCTCAGATACCAACTCGCC’ This manuscript pho4KO ORF.R 5’CAATTTGCTGAGAGCCATAGGC3’: This manuscript pho4KO 5’verF: 5’AGAGCTATATGGTATGACGAAC3’ This manuscript pho4KO 5’verR: 5’TGTGCTGATCATCCGATGCCAC3 This manuscript pho4KO 3’verF: 5’TGTGGAGGATGGTGGGGAATAG3 This manuscript pho4KO 3’verR: 5’GGACGTGAGCCAATAAGTTCCT3 This manuscript (Continued on next page) e2 Cell Host & Microbe 30, 1382–1400.e1–e8, October 12, 2022

Article Title: A dissemination-prone morphotype enhances extrapulmonary organ entry by Cryptococcus neoformans
Article Snippet: To estimate fungal microbial associated molecular pattern exposure, cells were stained at room temperature with 5 μg/mL fluorescein-conjugated wheat-germ agglutinin (WGA, Vector Laboratories catalog no. FL-1021) for 15 minutes to detect exposed chitin or 50 μg/mL fluorescein-conjugated concanavalin A (ConA, Vector Laboratories catalog no. FL-1001) for 5 minutes to detect exposed mannose. .. To estimate the percentage of cells bound by soluble host factors, we used the following antibodies: α-complement C3 (primary: mAb 11H9, ThermoFisher catalog no. MA1–40046; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11–4817-82), α-surfactant protein D (primary: polyclonal, Abcam catalog no. ab203309; secondary: Donkey anti-Rabbit IgG, AlexaFluor 405, Abcam catalog no. ab175651), α-mannose binding lectin A (primary: mAb 8G6, Hycult catalog no. HM1035; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11–4817-82), α-mannose binding lectin C (primary: mAb 14D12, Abcam catalog no. ab106046; secondary: Mouse anti-Rat IgG2a, FITC, Thermofisher catalog no. 11–4817-82), α-IgM (mAb II/41, FITC, BD Biosciences catalog no. 553437), α-IgA (mAb 11–44-2, FITC, SouthernBiotech catalog no. 1165–02). ..

Virus:

Recombinant:

Liposomes:

Control:

other:

Article Title: SGLT-2 inhibitors attenuate pattern recognition molecules collectin kidney 1 and mannose-binding lectin in kidney and liver in mice with diabetes.
Article Snippet: MBL-A were measured by coating with monoclonal 174 yeast mannan (1 μg/ml)[40] and detected by biotinylated monoclonal rat MBL-A 8G6 (0.5 μg/ml, Cat. 175 #: HM1035, Hycult Biotech) [41].

Review