Cloning:Article Title: Minigene assay to Evaluate CRISPR/Cas9-based excision of Intronic mutations that Cause Aberrant Splicing in Human Cells
Article Snippet: .. Add six additional nt upstream of the restriction sites to facilitate digestion by restriction enzymes. table ft1 table-wrap mode="anchored" t5 Minigenes cloning primers MGin12-in13fw CACACACTCGAGTGTGTTGTCCAGTTTTGGATGA MGin12-in13rv CTCACAGCTAGCACTGGTTTAGCATGAGGCGG MGin18-in20fw CTCACTCTCGAGTGACTAGGAATAGAATGGGGAGAG MGin18-in20rv CACACAGCTAGCACAATGGAAATTCAAAGAAATCACT MGin22-in23fw CACACACTCGAGACAGTACTGGATAGTCCTCTGA MGin22-in23rv CACACATCTAGAGCCTATGAGAAAACTGCACTGG Open in a separate window Amplify Target regions of interest from a wt genomic DNA sample (Genomic DNA-Human adult normal tissue Lung, from a single donor, Amsbio, Abingdon, UK) using Phusion high-fidelity DNA polymerase (Thermo Fisher) and designed primers using the following program in a Mastercycler Thermocycler (Eppendorf). .. PCR Amplification of genomic DNA to construct hybrid minigenes DNA template (20 ng/μl) 3 μl 5x Phusion Buffer 4 μl 10 mM dNTPS 0.4 μl 10 μM FW primer 0.5 μl 10 μM RV primer 0.5 μl Phusion polymerase 0.5 μl Nuclease-free water Up to 20 μl PCR program table ft1 table-wrap mode="anchored" t5 Initial Denaturation 98 °C 30 s 35 cycles of 98 °C 30 s 57 °C 30 s 72 °C 2 min Final extension 72 °C 10 min Hold 4 °C Open in a separate window Check successful amplification of the desired size by 1.5% agarose gel electrophoresis in TAE buffer, running 100 bp and 1 kb ladders as size standards and purify the PCR product using QIAquick PCR Purification Kit (QIAGEN).
Microarray:Article Title: On-target off-tumor toxicity of claudin18.2-directed CAR-T cells in preclinical models
Article Snippet: .. The following tissue microarrays were used: Human Multi-Organ Tissue MicroArray (Normal) (Novus Biologicals, NBP2-30189) and Mouse (BALB/c strain) multiple organ normal tissue array, 24 cases/ 54 cores, replacing MO541e (Amsbio, MO541f). .. Anti-CLDN18.2 (Zolbetuximab , hu8e5 , ) and mesothelin (M5) CAR T constructs were synthesized (GenScript) under the regulation of a human EF-1ɑ promoter and cloned into a third-generation lentiviral backbone.
Article Title: On-target off-tumor toxicity of claudin18.2-directed CAR-T cells in preclinical models.
Article Snippet: .. The following tissue microarrays were used: Human Multi-Organ Tissue MicroArray (Normal) (Novus Biologicals, NBP2-30189) and Mouse (BALB/c strain) multiple organ normal tissue array, 24 cases/ 54 cores, replacing MO541e (Amsbio, MO541f). .. Anti-CLDN18.2 (Zolbetuximab22, hu8e514,23) andmesothelin (M5) CART constructs were synthesized (GenScript) under the regulation of a human EF-1ɑ promoter and cloned into a third-generation lentiviral backbone.
Article Title: Novel human monoclonal antibodies specific to the alternatively spliced domain D of Tenascin C efficiently target tumors in vivo
Article Snippet: .. Antigen expression was confirmed on ice-cold acetone-fixed 10-μm cryostat sections of A431, U87, SKRC52, A375, Colon 26, C51, SMA-540, SMA-497, of frozen tumor and normal tissue specimens in microarray (Amsbio, T2635700) and of patient-derived glioblastoma stained with R6N IgG1-FITC (protein was FITC labeled according to manufacturer protocol; Sigma) (final concentration 10 μg/mL) and detected with rabbit anti-FITC (Bio-Rad, 4510–7804) and anti-rabbit AlexaFluor488 (Invitrogen; A11008). .. For vascular staining, rat anti-CD31 (BD Biosciences, 550274) and anti-rat AlexaFluor594 (Invitrogen; A21209) antibodies were used.
Formalin-fixed Paraffin-Embedded:Article Title: Zoonotic avian influenza viruses evade human BTN3A3 restriction
Article Snippet: .. Sections (3 μm thick) of formalin-fixed and paraffin-embedded (FFPE) human lung and respiratory nasal epithelium (female, 52 years old, Asian, post-mortem donor, normal tissue; code: AMS-41022-NE and 500029028-DS, Amsbio) were stained with a rabbit anti-BTN3A3 antibody (HPA 007904, Atlas antibodies) for 1.5 hours at room temperature after pressure cooking in sodium citrate. .. For visualisation, EnVision Detection System HRP, peroxidase/DAB (rabbit, K500711, Agilent) was used according to manufacturer’s instructions.
Article Title: Expression of non-neuronal Tau in humans and mice
Article Snippet: .. FFPE frozen TMAs comprising 22 different normal tissue types from a cohort of 66 adult donors were commercially available from AMS Biotechnology Europe Ltd (AMSBIO, catalogue number T8234701-1, Table S1). ..
Affinity Magnetic Separation:Article Title: Zoonotic avian influenza viruses evade human BTN3A3 restriction
Article Snippet: .. Sections (3 μm thick) of formalin-fixed and paraffin-embedded (FFPE) human lung and respiratory nasal epithelium (female, 52 years old, Asian, post-mortem donor, normal tissue; code: AMS-41022-NE and 500029028-DS, Amsbio) were stained with a rabbit anti-BTN3A3 antibody (HPA 007904, Atlas antibodies) for 1.5 hours at room temperature after pressure cooking in sodium citrate. .. For visualisation, EnVision Detection System HRP, peroxidase/DAB (rabbit, K500711, Agilent) was used according to manufacturer’s instructions.
Staining:Article Title: Zoonotic avian influenza viruses evade human BTN3A3 restriction
Article Snippet: .. Sections (3 μm thick) of formalin-fixed and paraffin-embedded (FFPE) human lung and respiratory nasal epithelium (female, 52 years old, Asian, post-mortem donor, normal tissue; code: AMS-41022-NE and 500029028-DS, Amsbio) were stained with a rabbit anti-BTN3A3 antibody (HPA 007904, Atlas antibodies) for 1.5 hours at room temperature after pressure cooking in sodium citrate. .. For visualisation, EnVision Detection System HRP, peroxidase/DAB (rabbit, K500711, Agilent) was used according to manufacturer’s instructions.
Article Title: Novel human monoclonal antibodies specific to the alternatively spliced domain D of Tenascin C efficiently target tumors in vivo
Article Snippet: .. Antigen expression was confirmed on ice-cold acetone-fixed 10-μm cryostat sections of A431, U87, SKRC52, A375, Colon 26, C51, SMA-540, SMA-497, of frozen tumor and normal tissue specimens in microarray (Amsbio, T2635700) and of patient-derived glioblastoma stained with R6N IgG1-FITC (protein was FITC labeled according to manufacturer protocol; Sigma) (final concentration 10 μg/mL) and detected with rabbit anti-FITC (Bio-Rad, 4510–7804) and anti-rabbit AlexaFluor488 (Invitrogen; A11008). .. For vascular staining, rat anti-CD31 (BD Biosciences, 550274) and anti-rat AlexaFluor594 (Invitrogen; A21209) antibodies were used.
Expressing:Article Title: Novel human monoclonal antibodies specific to the alternatively spliced domain D of Tenascin C efficiently target tumors in vivo
Article Snippet: .. Antigen expression was confirmed on ice-cold acetone-fixed 10-μm cryostat sections of A431, U87, SKRC52, A375, Colon 26, C51, SMA-540, SMA-497, of frozen tumor and normal tissue specimens in microarray (Amsbio, T2635700) and of patient-derived glioblastoma stained with R6N IgG1-FITC (protein was FITC labeled according to manufacturer protocol; Sigma) (final concentration 10 μg/mL) and detected with rabbit anti-FITC (Bio-Rad, 4510–7804) and anti-rabbit AlexaFluor488 (Invitrogen; A11008). .. For vascular staining, rat anti-CD31 (BD Biosciences, 550274) and anti-rat AlexaFluor594 (Invitrogen; A21209) antibodies were used.
Labeling:Article Title: Novel human monoclonal antibodies specific to the alternatively spliced domain D of Tenascin C efficiently target tumors in vivo
Article Snippet: .. Antigen expression was confirmed on ice-cold acetone-fixed 10-μm cryostat sections of A431, U87, SKRC52, A375, Colon 26, C51, SMA-540, SMA-497, of frozen tumor and normal tissue specimens in microarray (Amsbio, T2635700) and of patient-derived glioblastoma stained with R6N IgG1-FITC (protein was FITC labeled according to manufacturer protocol; Sigma) (final concentration 10 μg/mL) and detected with rabbit anti-FITC (Bio-Rad, 4510–7804) and anti-rabbit AlexaFluor488 (Invitrogen; A11008). .. For vascular staining, rat anti-CD31 (BD Biosciences, 550274) and anti-rat AlexaFluor594 (Invitrogen; A21209) antibodies were used.
Concentration Assay:Article Title: Novel human monoclonal antibodies specific to the alternatively spliced domain D of Tenascin C efficiently target tumors in vivo
Article Snippet: .. Antigen expression was confirmed on ice-cold acetone-fixed 10-μm cryostat sections of A431, U87, SKRC52, A375, Colon 26, C51, SMA-540, SMA-497, of frozen tumor and normal tissue specimens in microarray (Amsbio, T2635700) and of patient-derived glioblastoma stained with R6N IgG1-FITC (protein was FITC labeled according to manufacturer protocol; Sigma) (final concentration 10 μg/mL) and detected with rabbit anti-FITC (Bio-Rad, 4510–7804) and anti-rabbit AlexaFluor488 (Invitrogen; A11008). .. For vascular staining, rat anti-CD31 (BD Biosciences, 550274) and anti-rat AlexaFluor594 (Invitrogen; A21209) antibodies were used.
|
AMS Biotechnology is a verified supplier 
AMS Biotechnology manufactures this product 
