rnase hi overexpression (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
rnase hi overexpression
Rnase Hi Overexpression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/60365/pICE-RNaseHI-WT-NLS-mCherry+(Plasmid+%2360365)/pm38110032-218-0-4
Average 93 stars, based on 20 article reviews
Rnase Hi Overexpression, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/60365/pICE-RNaseHI-WT-NLS-mCherry+(Plasmid+%2360365)/pm38110032-218-0-4
Average 93 stars, based on 20 article reviews
rnase hi overexpression - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics. Article Snippet: .. The RNase H1 was PCR amplified from the Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics Article Snippet: .. The RNase H1 was PCR amplified from the Amplification:Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics. Article Snippet: .. The RNase H1 was PCR amplified from the Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics Article Snippet: .. The RNase H1 was PCR amplified from the Plasmid Preparation:Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics. Article Snippet: .. The RNase H1 was PCR amplified from the Article Title: Live-cell imaging unveils distinct R-loop populations with heterogeneous dynamics Article Snippet: .. The RNase H1 was PCR amplified from the Article Title: Chromatin compartmentalization regulates the response to DNA damage Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGGCUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGACGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAAUUAUUGCGUACU; and RNASEH1 (siRNASEH1) : CUGUCUUGCUGCCUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Article Title: Chromatin compartmentalization regulates the response to DNA damage. Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGG CUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGA CGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAA UUAUUGCGUACU; and RNASEH1 (siRNASEH1)48: CUGUCUUGCUGC CUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Over Expression:Article Title: Complex interplay between FMRP and DHX9 during DNA replication stress. Article Snippet: .. RNase HI overexpression. Transfection:Article Title: Complex interplay between FMRP and DHX9 during DNA replication stress. Article Snippet: .. RNase HI overexpression. Article Title: Complex interplay between FMRP and DHX9 during DNA replication stress Article Snippet: .. Article Title: Chromatin compartmentalization regulates the response to DNA damage Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGGCUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGACGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAAUUAUUGCGUACU; and RNASEH1 (siRNASEH1) : CUGUCUUGCUGCCUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Article Title: Chromatin compartmentalization regulates the response to DNA damage. Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGG CUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGA CGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAA UUAUUGCGUACU; and RNASEH1 (siRNASEH1)48: CUGUCUUGCUGC CUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Incubation:Article Title: Chromatin compartmentalization regulates the response to DNA damage Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGGCUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGACGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAAUUAUUGCGUACU; and RNASEH1 (siRNASEH1) : CUGUCUUGCUGCCUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Article Title: Chromatin compartmentalization regulates the response to DNA damage. Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGG CUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGA CGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAA UUAUUGCGUACU; and RNASEH1 (siRNASEH1)48: CUGUCUUGCUGC CUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Control:Article Title: Chromatin compartmentalization regulates the response to DNA damage Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGGCUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGACGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAAUUAUUGCGUACU; and RNASEH1 (siRNASEH1) : CUGUCUUGCUGCCUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and Article Title: Chromatin compartmentalization regulates the response to DNA damage. Article Snippet: For ATM or DNA-PK inhibition, cells were respectively pretreated for 1 h with 20 μM KU-55933 (Sigma-Aldrich, SML1109) or 2 μM NU-7441 (Selleckchem, S2638) and during subsequent OHT treatment. .. For cell synchronization, cells were incubated for 18 h with 2 mM thymidine (Sigma-Aldrich, T1895), then released during 11 h, followed by a second thymidine treatment for 18 h. S, G2 and G1 cells were then respectively treated with OHT at 0, 6 or 11 h after thymidine release and collected 4 h later. siRNA and plasmid transfections were performed using the 4D-Nucleofector kit and the SE cell line 4D-Nucleofector X L or S kit (Lonza) according to the manufacturer’s instructions, and subsequent treatment(s) were performed 48 h later. siRNA transfections were performed using a control siRNA (siCtrl): CAUGUCAUGUGUCACAUCU; or siRNA targeting SCC1 (siSCC1): GGUGAAAAUGGCAUUACGG; SMC1 (siSMC1): UAGG CUUCCUGGAGGUCACAUUUAA; 53BP1 (si53BP1): GAACGAGGAGA CGGUAAUA; SUN2 (siSUN2): CGAGCCTATTCAGACGTTTCA; ARP2 (siARP2): GGCACCGGGUUUGUGAAGU; SETX (siSETX): GAGAGAA UUAUUGCGUACU; and RNASEH1 (siRNASEH1)48: CUGUCUUGCUGC CUGUACU. pICE-NLS-mCherry (referred to as pICE-empty in the text; Addgene plasmid, 60364) and |