Review



cu zn superoxide dismutase  (Valiant Co Ltd)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Valiant Co Ltd cu zn superoxide dismutase
    Cu Zn Superoxide Dismutase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pmc03081918-102-13-18
    Average 96 stars, based on 45 article reviews
    cu zn superoxide dismutase - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: MANUMYCIN-A IS A POTENT INHIBITOR OF MAMMALIAN THIOREDOXIN REDUCTASE-1 (TRXR-1)
    Article Snippet: Cytochrome c was purchased from Lee biochemical and superoxide dismutase was purchased from MP Biomedicals.

    Article Title: Effect of substitution of taurine for methionine and additional taurine supplementation on the performance and antioxidative capacity of laying hens.
    Article Snippet: NM_001031215.1 114 HO-1 F:CTTCGCACAAGGAGTGTTAAC R:CATCCTGCTTGTCCTCTCAC NM_205344.1 78 Abbreviations: CAT, catalase; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; GCLC, glutamate-cysteine ligase catalytic subunit; GCLM, glutamate-cysteine ligase modifier subunit; GSR, glutathione reductase; GSS, glutathione synthetase; HO-1, heme oxygenase 1; Nrf2, nuclear factor erythroid 2-related factor 2; SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2. and intestinal content, the material was digested with collagenase I (MP Biomedicals, United States) at 37°C then was filtered following centrifuged at 800 rpm for 10 min.



    Similar Products

    superoxide dismutase  (Valiant Co Ltd)
    96
    Valiant Co Ltd superoxide dismutase
    Superoxide Dismutase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pm29670693__ml7b00489_si_001-5-8-13
    Average 96 stars, based on 1 article reviews
    superoxide dismutase - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    superoxide dismutase 1  (Valiant Co Ltd)
    96
    Valiant Co Ltd superoxide dismutase 1
    Superoxide Dismutase 1, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pm36587450-98-41-58
    Average 96 stars, based on 1 article reviews
    superoxide dismutase 1 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    superoxide dismutase 2  (Valiant Co Ltd)
    96
    Valiant Co Ltd superoxide dismutase 2
    Superoxide Dismutase 2, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pm36587450-98-45-58
    Average 96 stars, based on 1 article reviews
    superoxide dismutase 2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    cu zn superoxide dismutase  (Valiant Co Ltd)
    96
    Valiant Co Ltd cu zn superoxide dismutase
    Cu Zn Superoxide Dismutase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pm34714071-34-4-8
    Average 96 stars, based on 1 article reviews
    cu zn superoxide dismutase - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    bovine cu zn superoxide dismutase sod  (Valiant Co Ltd)
    96
    Valiant Co Ltd bovine cu zn superoxide dismutase sod
    ESI-MS of Cu/Zn superoxide <t>dismutase</t> <t>(SOD)</t> in a) 20 mM m-NBA, 80 mM ammonium acetate solution for supercharging, b) 100 mM ammonium acetate (standard native MS solution), and c) 20 mM triethylammonium acetate, 80 mM ammonium acetate for charge-reducing native solutions.
    Bovine Cu Zn Superoxide Dismutase Sod, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pmc06580417-91-0-8
    Average 96 stars, based on 1 article reviews
    bovine cu zn superoxide dismutase sod - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    superoxide dismutase sod  (Valiant Co Ltd)
    96
    Valiant Co Ltd superoxide dismutase sod
    ESI-MS of Cu/Zn superoxide <t>dismutase</t> <t>(SOD)</t> in a) 20 mM m-NBA, 80 mM ammonium acetate solution for supercharging, b) 100 mM ammonium acetate (standard native MS solution), and c) 20 mM triethylammonium acetate, 80 mM ammonium acetate for charge-reducing native solutions.
    Superoxide Dismutase Sod, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/pm29420883-51-0-7
    Average 96 stars, based on 1 article reviews
    superoxide dismutase sod - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    superoxidase dismutase  (Valiant Co Ltd)
    96
    Valiant Co Ltd superoxidase dismutase
    ESI-MS of Cu/Zn superoxide <t>dismutase</t> <t>(SOD)</t> in a) 20 mM m-NBA, 80 mM ammonium acetate solution for supercharging, b) 100 mM ammonium acetate (standard native MS solution), and c) 20 mM triethylammonium acetate, 80 mM ammonium acetate for charge-reducing native solutions.
    Superoxidase Dismutase, supplied by Valiant Co Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/0219011703/Superoxide+dismutase/10__1038_slash_s41557___019___0317___7____41557_2019_317_MOESM58_ESM-28-9-14
    Average 96 stars, based on 1 article reviews
    superoxidase dismutase - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    ESI-MS of Cu/Zn superoxide dismutase (SOD) in a) 20 mM m-NBA, 80 mM ammonium acetate solution for supercharging, b) 100 mM ammonium acetate (standard native MS solution), and c) 20 mM triethylammonium acetate, 80 mM ammonium acetate for charge-reducing native solutions.

    Journal: Physical chemistry chemical physics : PCCP

    Article Title: Impact of charge state on 193 nm ultraviolet photodissociation of protein complexes

    doi: 10.1039/c9cp01144g

    Figure Lengend Snippet: ESI-MS of Cu/Zn superoxide dismutase (SOD) in a) 20 mM m-NBA, 80 mM ammonium acetate solution for supercharging, b) 100 mM ammonium acetate (standard native MS solution), and c) 20 mM triethylammonium acetate, 80 mM ammonium acetate for charge-reducing native solutions.

    Article Snippet: Bovine Cu/Zn superoxide dismutase (SOD) was obtained from MP Biomedicals (Santa Ana, CA), streptavidin (SA) from ProteoChem (Hurricane, UT), human hemoglobin (Hb) from Sigma Aldrich (St. Louis, MO), transthyretin (TTR) from Lee BioSolutions (Maryland Heights, MO), and C-reactive protein (CRP) from EMD Millipore (Burlington, MA).

    Techniques:

    Percent sequence coverage of all of the charge states generated from supercharging, standard, and charge-reducing solutions for a) superoxide dismutase (SOD), b) streptavidin (SA), c) transthyretin (TTR), d) hemoglobin (Hb), e) C-reactive protein (CRP). A single pulse of 3 mJ was used for all UVPD measurements. HCD energy was optimized for each protein and ranged from 1400 to 2500 eV lab frame collision energy. Error bars equal to standard deviation of replicate data. Charge states with insufficient abundances for MS/MS analysis are not included.

    Journal: Physical chemistry chemical physics : PCCP

    Article Title: Impact of charge state on 193 nm ultraviolet photodissociation of protein complexes

    doi: 10.1039/c9cp01144g

    Figure Lengend Snippet: Percent sequence coverage of all of the charge states generated from supercharging, standard, and charge-reducing solutions for a) superoxide dismutase (SOD), b) streptavidin (SA), c) transthyretin (TTR), d) hemoglobin (Hb), e) C-reactive protein (CRP). A single pulse of 3 mJ was used for all UVPD measurements. HCD energy was optimized for each protein and ranged from 1400 to 2500 eV lab frame collision energy. Error bars equal to standard deviation of replicate data. Charge states with insufficient abundances for MS/MS analysis are not included.

    Article Snippet: Bovine Cu/Zn superoxide dismutase (SOD) was obtained from MP Biomedicals (Santa Ana, CA), streptavidin (SA) from ProteoChem (Hurricane, UT), human hemoglobin (Hb) from Sigma Aldrich (St. Louis, MO), transthyretin (TTR) from Lee BioSolutions (Maryland Heights, MO), and C-reactive protein (CRP) from EMD Millipore (Burlington, MA).

    Techniques: Sequencing, Generated, Standard Deviation, Tandem Mass Spectroscopy