Staining:Article Title: Region-specific roles of stress-activated protein kinase MKK7 in the developing and maturing murine brain
Article Snippet: Both sagittal and cortical sections of paraffin-embedded tissues were prepared using Microm HM325 (Thermo Scientific) to achieve a thickness of 5 μm. .. For H&E staining, deparaffinized sections were soaked in Mayer’s Hematoxylin Solution (Millipore) for 10 min, washed rapidly with water, and incubated in Eosin Y Solution for 3 min. For cresyl violet staining, deparaffinized sections were incubated in 0.1% cresyl violet solution (MP Biomedicals) for 10 min at 37 °C. ..
Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Article Title: Region-specific roles of stress-activated protein kinase MKK7 in the developing and maturing murine brain.
Article Snippet: Both sagittal and cortical sections of paraffin-embedded tissues were prepared using Microm HM325 (Thermo Scientific) to achieve a thickness of 5 μm. .. For H&E staining, deparaffinized sections were soaked in Mayer’s Hematoxylin Solution (Millipore) for 10 min, washed rapidly with water, and incubated in Eosin Y Solution for 3 min. For cresyl violet staining, deparaffinized sections were incubated in 0.1% cresyl violet solution (MP Biomedicals) for 10 min at 37 °C. ..
Incubation:Article Title: Region-specific roles of stress-activated protein kinase MKK7 in the developing and maturing murine brain
Article Snippet: Both sagittal and cortical sections of paraffin-embedded tissues were prepared using Microm HM325 (Thermo Scientific) to achieve a thickness of 5 μm. .. For H&E staining, deparaffinized sections were soaked in Mayer’s Hematoxylin Solution (Millipore) for 10 min, washed rapidly with water, and incubated in Eosin Y Solution for 3 min. For cresyl violet staining, deparaffinized sections were incubated in 0.1% cresyl violet solution (MP Biomedicals) for 10 min at 37 °C. ..
Article Title: Region-specific roles of stress-activated protein kinase MKK7 in the developing and maturing murine brain.
Article Snippet: Both sagittal and cortical sections of paraffin-embedded tissues were prepared using Microm HM325 (Thermo Scientific) to achieve a thickness of 5 μm. .. For H&E staining, deparaffinized sections were soaked in Mayer’s Hematoxylin Solution (Millipore) for 10 min, washed rapidly with water, and incubated in Eosin Y Solution for 3 min. For cresyl violet staining, deparaffinized sections were incubated in 0.1% cresyl violet solution (MP Biomedicals) for 10 min at 37 °C. ..
other:Article Title: Combinatorial High-Throughput Screening of Complex Polymeric Enzyme Immobilization Supports.
Article Snippet: Recent advances have demonstrated the promise of complex multicomponent polymeric supports to enable suprabiological enzyme performance.. However, the discovery of such supports has been limited by time-consuming, low-throughput synthesis and screening.. Here, we describe a novel combinatorial and high-throughput platform that enables rapid screening of complex and heterogeneous copolymer brushes as enzyme immobilization supports, named combinatorial high-throughput enzyme support screening (CHESS).
Recombinant:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Saline:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Control:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Reverse Transcription:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Polymerase Chain Reaction:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
SYBR Green Assay:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
Library Quantification:Article Title: Protocol for high-quality single-cell RNA-seq from tissue sections with DRaqL.
Article Snippet: .. AGENT or RESOURCE SOURCE IDENTIFIER emicals, peptides, and recombinant proteins ium deoxycholate Nacalai Tesque 02889-72 on X-100 Nacalai Tesque 12967-32 in Y stain solution (0.17% Eosin Y, ethanol) (optional) Muto Pure Chemicals 32051 syl violet acetate MP Biomedicals 150727 tilled water (dH2O) Thermo Fisher Scientific 15230-162 TP mixture (25 mM each) Nippon Gene 312-07271 hiothreitol (DTT) (100 mM) Thermo Fisher Scientific Attached with Superscript Cl2 (1 M) Merck M1028-100ML aine Sigma 61962-50G anol Wako 054-07225 propanol Wako 168-21675 vine serum albumin (BSA) (20 mg/mL) Takara Bio 2320 yvinyl alcohol (PVA) Sigma P8136-250G timal cutting temperature T) compound (optional) Sakura Finetek Japan 4583 Phosphate-buffered saline (PBS) Nacalai Tesque 11480-35 -HCl (pH 8.0) (1 M) Nacalai Tesque 06938-44 een 20 Wako 166-21213 X Control v3 DNA Illumina FC-110-3001 ium dodecyl sulfate (SDS) (alternative) Wako 194-13402 ium N-lauroylsarcosinate (alternative) Wako 121-05502 ium cholate (cholic acid sodium salt) (alternative) Nacalai Tesque 06315-94 yoxyethylene (23) lauryl ether (Brij L23, Brij 35) (alternative) Sigma B4184-100ML tical commercial assays erscript II Thermo Fisher Scientific 18064014 erscript III Thermo Fisher Scientific 18080044 ombinant RNase inhibitor (40 U/mL) Takara Bio 2313A aseOUT recombinant ribonuclease ibitor (40 U/mL) (alternative) Thermo Fisher Scientific 10777019 Amp DNA polymerase Takara Bio 638504 C RNA Spike-In Mix 1 Thermo Fisher Scientific 4456740 eScript II reverse transcriptase (alternative) Takara Bio 2690A GEN protease (7.5 AU, lyophilized) (optional) QIAGEN #19155 Prep MAG PCR clean-up kit Corning MAG-PCR-CL-50 xtera XT DNA Library Prep Kit Illumina FC-131-1024 Pure XP reagent (alternative) Beckman Coulter A63881 Power SYBR Green PCR master mix Thermo Fisher Scientific 4368706 bit 1X dsDNA High Sensitivity (HS) Broad Range (BR) Assay Kits Invitrogen Q33231 ilent High Sensitivity DNA Kit Agilent Technologies 5067-4626 PA Library Quantification Kits Kapa Biosystems KK4824 xtSeq 500/550 High-Output Kit v2.5 (75 Cycles) Illumina 20024906 xtSeq 2000 P3 reagents (50 Cycles) (alternative) Illumina 20046810 gonucleotides go dT VN IL (100 mM): AAGCAGTGG TCAACGCAGAGTACGTGTGCTCT CGATCT [IL index] TTTTTTTTTTTTT TTTTTTTTTTTTTTVN (V: A/C/G. ..
|