16112001 chemical compound (Chem Impex International)
Chem Impex International is a verified supplier 
Chem Impex International manufactures this product 
95
Structured Review
Chem Impex International
16112001 chemical compound
16112001 Chemical Compound, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00268/Caprylic+acid+sodium+salt/10__7554_slash_elife__82595-362-171-165
Average 95 stars, based on 1 article reviews
16112001 Chemical Compound, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00268/Caprylic+acid+sodium+salt/10__7554_slash_elife__82595-362-171-165
Average 95 stars, based on 1 article reviews
16112001 chemical compound - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Western Blot:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, Recombinant:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, Plasmid Preparation:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, Expressing:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, Sequencing:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, Polymerase Chain Reaction:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, SYBR Green Assay:Article Title: Host-microbiome metabolism of a plant toxin in bees Article Snippet: M6- 3G doi:10.1128/mBio.01326–16 MCIU00000000 Bacterial isolate Biological sample (Apis mellifera) Western honey bee Apis mellifera Collected from hives at UT- Austin Recombinant DNA reagent pGEM- T Easy vector (plasmid) Promega Cat#: A1360 Recombinant DNA reagent pET25b (plasmid) Novagen Cat#: 69753 Recombinant DNA reagent pET25b- wkB204- GH3 (plasmid) This study pET25b expressing wkB204GH3 (WP_254476944) Recombinant DNA reagent pET25b- wkB344- GH3 (plasmid) This study pET25b expressing wkB344GH3 (WP_121913979) Sequence- based reagent B- GH3- F This paper PCR primers ctaccgcaatcccgacct Sequence- based reagent B- GH3- R This paper PCR primers cacctccttgtccactccc Sequence- based reagent GH3- NdeI- F This paper PCR primers ttgtttaactttaagaaggagatatacatatggcat caaggaagttgacagagg Sequence- based reagent GH3- HindIII- R This paper PCR primers agcccgtttgatctcgagtgcggccgcaa gcttacccacggtcaccgtca Commercial assay or kit Quick- RNA Miniprep kit Zymo Research Cat#: R1055 Commercial assay or kit iTaq Universal SYBR Green Supermix Bio- Rad Cat#: 172–5125 Commercial assay or kit Monarch Plasmid Miniprep Kit New England BioLabs Cat#: T1010L Commercial assay or kit qScript cDNA Synthesis Kit QuantBio Cat#: 95047–500 Chemical compound, |
