Review

methyl (Chem Impex International)

Chem Impex International is a verified supplier

Chem Impex International manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Chem Impex International methyl
Chromatograms of plasma for 5-azacytidine (A) LLOQ (5 ng/mL), (B) predose patient sample, (C) patient sample with 446 ng/mL of 5-azacytidine, and (D) internal standard <t>(5-methyl-2′-deoxycytine).</t>

Chromatograms of plasma for 5-azacytidine (A) LLOQ (5 ng/mL), (B) predose patient sample, (C) patient sample with 446 ng/mL of 5-azacytidine, and (D) internal standard <t>(5-methyl-2′-deoxycytine).</t>

Methyl, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/5-Methyl-2'-deoxycytidine/pmc04713385-40-13-19
Average 95 stars, based on 2 article reviews

methyl - by Bioz Stars, 2026-09

95/100 stars

Images

1) Product Images from "A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine"

Article Title: A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine

Journal: Biomedical chromatography : BMC

doi: 10.1002/bmc.3562

Figure Legend Snippet: Chromatograms of plasma for 5-azacytidine (A) LLOQ (5 ng/mL), (B) predose patient sample, (C) patient sample with 446 ng/mL of 5-azacytidine, and (D) internal standard (5-methyl-2′-deoxycytine).

Techniques Used:

other:

Article Title: A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine
Article Snippet: Chemical and Reagents 5-azacytidine was obtained from MP Biomedicals (Santa Ana, CA) and 5-methyl-2′-deoxycytidine (5-Me-2′DC), the internal standard, from Chem-Impex International (Wood Dale, IL) ( Supplemental Fig 1 ).

Article Title: A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine
Article Snippet: 5-azacytidine was obtained from MP Biomedicals (Santa Ana, CA) and 5-methyl-2′-deoxycytidine (5-Me-2′DC), the internal standard, from Chem-Impex International (Wood Dale, IL) ( Supplemental Fig 1 ).

Article Title: A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine
Article Snippet: 5-Azacytidine was obtained fromMP Biomedicals (Santa Ana, CA, USA) and 5-methyl-2′-deoxycytidine, the internal standard, from Chem-Impex International (Wood Dale, IL, USA) (Supporting Information, Fig. S1).

Purification:

Article Title: Efficient large-scale synthesis of 5'-O-dimethoxytrityl-N4-benzoyl-5-methyl-2'-deoxycytidine.
Article Snippet: This article was downloaded by: [University of Tennessee, Knoxville] On: 17 November 2012, At: 14:33 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Nucleosides, Nucleotides and Nucleic Acids Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/lncn20 Efficient Large-Scale Synthesis of 5′-ODimethoxytrityl-N 4-Benzoyl-5-Methyl-2′Deoxycytidine Bruce S. Ross a , Mingming Han a & Vasulinga T. Ravikumar a a Isis Pharmaceuticals, Inc., Carlsbad, California, USA Version of record first published: 24 Feb 2007.. To cite this article: Bruce S. Ross, Mingming Han & Vasulinga T. Ravikumar (2006): Efficient LargeScale Synthesis of 5′-O-Dimethoxytrityl-N 4-Benzoyl-5-Methyl-2′-Deoxycytidine, Nucleosides, Nucleotides and Nucleic Acids, 25:7, 765-770 To link to this article: http://dx.doi.org/10.1080/15257770600726059 PLEASE SCROLL DOWN FOR ARTICLE Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions This article may be used for research, teaching, and private study purposes.. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden.

Similar Products

gatcctgagataagactccatgg cyagen biosciences nlrp6 grna4 (Cyagen Biosciences)

Cyagen Biosciences gatcctgagataagactccatgg cyagen biosciences nlrp6 grna4
Gatcctgagataagactccatgg Cyagen Biosciences Nlrp6 Grna4, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pmc12573374__gutjnl-74-11-s011-1-224-225
Average 93 stars, based on 1 article reviews

gatcctgagataagactccatgg cyagen biosciences nlrp6 grna4 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

catccatggagtcttatctcagg cyagen biosciences nlrp6 grna2 (Cyagen Biosciences)

Cyagen Biosciences catccatggagtcttatctcagg cyagen biosciences nlrp6 grna2
Catccatggagtcttatctcagg Cyagen Biosciences Nlrp6 Grna2, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pmc12573374__gutjnl-74-11-s011-1-204-205
Average 93 stars, based on 1 article reviews

catccatggagtcttatctcagg cyagen biosciences nlrp6 grna2 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

sequence supplier nlrp6 grna1 (Cyagen Biosciences)

Cyagen Biosciences sequence supplier nlrp6 grna1
Sequence Supplier Nlrp6 Grna1, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pmc12573374__gutjnl-74-11-s011-1-195-205
Average 93 stars, based on 1 article reviews

sequence supplier nlrp6 grna1 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

ggaactatattggcggagcttgg cyagen biosciences nlrp6 grna3 (Cyagen Biosciences)

Cyagen Biosciences ggaactatattggcggagcttgg cyagen biosciences nlrp6 grna3
Ggaactatattggcggagcttgg Cyagen Biosciences Nlrp6 Grna3, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pmc12573374__gutjnl-74-11-s011-1-214-215
Average 93 stars, based on 1 article reviews

ggaactatattggcggagcttgg cyagen biosciences nlrp6 grna3 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

nlrp6 (Cyagen Biosciences)

Cyagen Biosciences nlrp6
Nlrp6, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pmc12573374__gutjnl-74-11-s012-38-4-23
Average 93 stars, based on 1 article reviews

nlrp6 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

a f (Biosynth Carbosynth)

Biosynth Carbosynth a f
A F, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/A-F-A/pm40605271-641-1-3
Average 93 stars, based on 1 article reviews

a f - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

mice cyagen koai181010jn4 nlrp6 (Cyagen Biosciences)

Cyagen Biosciences mice cyagen koai181010jn4 nlrp6

Figure 1. ERb inhibits DSS-induced colitis via <t>NLRP6</t> WT and Esr2/ male mice were administered 3% DSS in drinking water for 7 days (n = 5). (A) NLRP6, ASC, and Casp-1 p20 expression of mouse colon homogenate. (B) Tissue IL-1b, IL-1a, IL-6, IL-8, and TNF-a levels were measured by ELISA. The statistics are shown as mean ± SEM. **p < 0.01, ***p < 0.001, n.s., not sig- niﬁcant, by unpaired Student’s t test. WT male mice were administered 3% DSS in drinking water for 7 days following intraperitoneal (i.p.) IL-1b (1 mg/kg body weight) or TNF-a (500 ng/kg body weight) with(out) ERB-041 (5 mg/kg body weight) injection for 5 days (n = 3). (C) Weight loss of different mice. Data represent mean values ±SEM. ****p < 0.0001, by two-way ANOVA with Tukey’s post hoc test.

Mice Cyagen Koai181010jn4 Nlrp6, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/Nlrp6/pm36223738-610-6-7
Average 93 stars, based on 1 article reviews

mice cyagen koai181010jn4 nlrp6 - by Bioz Stars, 2026-09

93/100 stars

Buy from Supplier

methyl (Chem Impex International)

Chem Impex International methyl

Methyl, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/00214/5-Methyl-2'-deoxycytidine/pmc04713385-50-10-16
Average 95 stars, based on 1 article reviews

methyl - by Bioz Stars, 2026-09

95/100 stars

Buy from Supplier

Image Search Results

Figure 1. ERb inhibits DSS-induced colitis via NLRP6 WT and Esr2/ male mice were administered 3% DSS in drinking water for 7 days (n = 5). (A) NLRP6, ASC, and Casp-1 p20 expression of mouse colon homogenate. (B) Tissue IL-1b, IL-1a, IL-6, IL-8, and TNF-a levels were measured by ELISA. The statistics are shown as mean ± SEM. **p < 0.01, ***p < 0.001, n.s., not sig- niﬁcant, by unpaired Student’s t test. WT male mice were administered 3% DSS in drinking water for 7 days following intraperitoneal (i.p.) IL-1b (1 mg/kg body weight) or TNF-a (500 ng/kg body weight) with(out) ERB-041 (5 mg/kg body weight) injection for 5 days (n = 3). (C) Weight loss of different mice. Data represent mean values ±SEM. ****p < 0.0001, by two-way ANOVA with Tukey’s post hoc test.

Journal: Cell reports

Article Title: Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy.

doi: 10.1016/j.celrep.2022.111454

Figure Lengend Snippet: Figure 1. ERb inhibits DSS-induced colitis via NLRP6 WT and Esr2/ male mice were administered 3% DSS in drinking water for 7 days (n = 5). (A) NLRP6, ASC, and Casp-1 p20 expression of mouse colon homogenate. (B) Tissue IL-1b, IL-1a, IL-6, IL-8, and TNF-a levels were measured by ELISA. The statistics are shown as mean ± SEM. **p < 0.01, ***p < 0.001, n.s., not sig- niﬁcant, by unpaired Student’s t test. WT male mice were administered 3% DSS in drinking water for 7 days following intraperitoneal (i.p.) IL-1b (1 mg/kg body weight) or TNF-a (500 ng/kg body weight) with(out) ERB-041 (5 mg/kg body weight) injection for 5 days (n = 3). (C) Weight loss of different mice. Data represent mean values ±SEM. ****p < 0.0001, by two-way ANOVA with Tukey’s post hoc test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Nlrp6+/- mice Cyagen KOAI181010JN4 Nlrp6-/- mice This paper N/A DH5a Competent Cells Sangon Biotech B528413 BL21(DE3) Competent E. coli New England Biolabs C2527H Stbl3 Competent Cells Beyotime D0378 Oligonucleotides See Table S1 N/A Recombinant DNA HA-p62 Life Science Market PVT10361 pCAGGS Life Science Market PVT1020 pCMV3-HA-ULK1 Life Science Market PVT14404 pCAGGS- mCherry-BECN1 This paper N/A pCAGGS- mCherry-ATG16L1 This paper N/A pCAGGS- mCherry-LC3B This paper N/A pCAGGS-EGFP-NLRP6 This paper N/A pCAGGS-mCherry-p62 This paper N/A pCAGGS- mCherry-PHB2 This paper N/A pCAGGS- mCherry-ULK1 This paper N/A pEGFP-N1-PYCARD-FLAG Life Science Market PVT20219 pEGFP-N1-NLRP6-FLAG This paper N/A pEGFP-N1-PYD-FLAG This paper N/A pEGFP-N1-PYD + NBD-FLAG This paper N/A pEGFP-N1-LRR-FLAG This paper N/A pGEX-4T-1 Life Science Market PVT0029 pGEX-4T-1-ERb This paper N/A pGEX-4T-1-NLRP6 This paper N/A pGL3-basic Promega E1751 pGL3-control Promega E1741 pGL3-Nlrp6 promoter This paper N/A pRL-TK Promega E2241 pMD2.G Life Science Market PVT2321 psPAX2 Life Science Market PVT2320 pLVX-sh Nlrp6 This paper N/A pLVX-sh RNA2 Clontech PT4052-5 Software and algorithms Flowjo Flowjo Software https://www.flowjo.com/ GraphPad Prism 7 GraphPad Software https://www.graphpad.com/ scientific-software/prism/ ImageJ ImageJ Software https://imagej.nih.gov/ij/ Image-Pro Plus 6.0 Image-Pro Plus Software https://image-pro-plus.software. informer.com/6.0/ ZEN 3.0 (blue edition) Zeiss https://www.zeiss.com/microscopy/ int/products/microscope-software/zen.html/

Techniques: Expressing, Enzyme-linked Immunosorbent Assay, Injection

Figure 2. ERb activates NLRP6 gene expression and inﬂammasome assembly in colon epithelial cells and intestinal tissues Human colon mucosal epithelial cells (NCM-460) were stimulated with 3% DSS for 24 h, then treated by ERB-041 (1 mM) for 48 h. (A) Cell viability of treated cells was detected by the CCK-8 method. Cytokine (IL-1b and TNF-a) levels in the supernatant were determined by ELISA. Each data point represents a unique experiment performed in triplicate. Data represent mean values ±SEM. *p < 0.05, p = 0.07, by unpaired Student’s t test. (B) Immunoblotting of treated cell lysates. Data are representative of three independent experiments. *p < 0.05, **p < 0.01, by two-way ANOVA with Tukey’s post hoc analysis. Normal NCM-460 cells were stimulated with the selective ERb agonist (ERB-041, 1 mM) and ERa agonist (PPT, 1 mM) for 48 h. (C) Gel-shift assays with the NLRP6 probe and nuclear lysate.

Journal: Cell reports

Article Title: Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy.

doi: 10.1016/j.celrep.2022.111454

Figure Lengend Snippet: Figure 2. ERb activates NLRP6 gene expression and inﬂammasome assembly in colon epithelial cells and intestinal tissues Human colon mucosal epithelial cells (NCM-460) were stimulated with 3% DSS for 24 h, then treated by ERB-041 (1 mM) for 48 h. (A) Cell viability of treated cells was detected by the CCK-8 method. Cytokine (IL-1b and TNF-a) levels in the supernatant were determined by ELISA. Each data point represents a unique experiment performed in triplicate. Data represent mean values ±SEM. *p < 0.05, p = 0.07, by unpaired Student’s t test. (B) Immunoblotting of treated cell lysates. Data are representative of three independent experiments. *p < 0.05, **p < 0.01, by two-way ANOVA with Tukey’s post hoc analysis. Normal NCM-460 cells were stimulated with the selective ERb agonist (ERB-041, 1 mM) and ERa agonist (PPT, 1 mM) for 48 h. (C) Gel-shift assays with the NLRP6 probe and nuclear lysate.

Techniques: Gene Expression, CCK-8 Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Gel Shift

Figure 3. The role of ERb and NLRP6 in inﬂammation, mitochondrial damage, and autophagy NCM-460 cells (a), NLRP6 knockdown (Sh-NLRP6, b), and ERb knockdown (Sh-ERb, c) NCM-460 cells were stimulated with 3% DSS for 24 h, then treated with IL-1b (10 ng/mL) or TNF-a (5 ng/mL) together with or without ERB-041 (1 mM) for 48 h. (A) Cell viability of treated cells was detected by the CCK-8 method. Cytokines (IL-1b and TNF-a) levels in the supernatant were determined by ELISA. (B) After treatment, cells were incubated with Mito-SOX and then examined by Flow Cytometer. Histogram quantiﬁcation of ROS-positive cells is indicated in Figure S3B. (C) Representative transmission electron microscope images of mitochondria in different group. Scale bars, 500 nm.

Journal: Cell reports

Article Title: Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy.

doi: 10.1016/j.celrep.2022.111454

Figure Lengend Snippet: Figure 3. The role of ERb and NLRP6 in inﬂammation, mitochondrial damage, and autophagy NCM-460 cells (a), NLRP6 knockdown (Sh-NLRP6, b), and ERb knockdown (Sh-ERb, c) NCM-460 cells were stimulated with 3% DSS for 24 h, then treated with IL-1b (10 ng/mL) or TNF-a (5 ng/mL) together with or without ERB-041 (1 mM) for 48 h. (A) Cell viability of treated cells was detected by the CCK-8 method. Cytokines (IL-1b and TNF-a) levels in the supernatant were determined by ELISA. (B) After treatment, cells were incubated with Mito-SOX and then examined by Flow Cytometer. Histogram quantiﬁcation of ROS-positive cells is indicated in Figure S3B. (C) Representative transmission electron microscope images of mitochondria in different group. Scale bars, 500 nm.

Techniques: Knockdown, CCK-8 Assay, Enzyme-linked Immunosorbent Assay, Incubation, Flow Cytometry, Transmission Assay, Microscopy

Figure 4. ERb-NLRP6 promotes autophagic ﬂux and interacts with autophagy-related proteins NCM-460 cells, NLRP6 knockdown (Sh-NLRP6), and ERb knockdown (Sh-ERb) NCM-460 cells were treated with 3% DSS for 24 h, then treated with ERB-041 (1 mM) for 48 h. (A) Western blots were probed with speciﬁc anti-ULK1, anti-BECN1, anti-ATG16L1, anti-LC3, anti-p62, and anti-PHB2 antibodies. (B) Western blot analysis of colon tissue from WT, Esr2/, and Nlrp6/ mice treated with or without 3% DSS. Western blots were probed with speciﬁc anti- ULK1, anti-BECN1, anti-ATG5, anti-ATG12, anti-ATG16L1, anti-p62, and anti-PHB2 antibodies. (C) Confocal microscopy of EGFP-mCherry-LC3B (yellow) expressed in treated NCM-460 cells, Sh-NLRP6, and Sh-ERb cells. Scale bars, 10 mm.

Journal: Cell reports

Article Title: Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy.

doi: 10.1016/j.celrep.2022.111454

Figure Lengend Snippet: Figure 4. ERb-NLRP6 promotes autophagic ﬂux and interacts with autophagy-related proteins NCM-460 cells, NLRP6 knockdown (Sh-NLRP6), and ERb knockdown (Sh-ERb) NCM-460 cells were treated with 3% DSS for 24 h, then treated with ERB-041 (1 mM) for 48 h. (A) Western blots were probed with speciﬁc anti-ULK1, anti-BECN1, anti-ATG16L1, anti-LC3, anti-p62, and anti-PHB2 antibodies. (B) Western blot analysis of colon tissue from WT, Esr2/, and Nlrp6/ mice treated with or without 3% DSS. Western blots were probed with speciﬁc anti- ULK1, anti-BECN1, anti-ATG5, anti-ATG12, anti-ATG16L1, anti-p62, and anti-PHB2 antibodies. (C) Confocal microscopy of EGFP-mCherry-LC3B (yellow) expressed in treated NCM-460 cells, Sh-NLRP6, and Sh-ERb cells. Scale bars, 10 mm.

Techniques: Knockdown, Western Blot, Confocal Microscopy

Figure 6. NLRP6 is required for Rap-induced recovery from inﬂammation WT male mice were administered 3% DSS in drinking water for 7 days followed by intraperitoneal (i.p.) injection of saline or the ERB-041 (5 mg/kg body weight) with or without 3-MA (1.5 mg/kg body weight) for 5 days (n = 5). (A) Weight loss of colitis model mice. Data represent mean values ±SEM. **p < 0.01, n.s., not signiﬁcant, by two-way ANOVA with Tukey’s post hoc test. (B) Representative gross photographs and the colon length of different mice. (C) Representative H&E staining of distal colon sections from mice. Scale bars, 200 mm. (D) Tissue IL-1b and TNF-a levels were measured by ELISA.

Journal: Cell reports

Article Title: Estrogen receptor β activation inhibits colitis by promoting NLRP6-mediated autophagy.

doi: 10.1016/j.celrep.2022.111454

Figure Lengend Snippet: Figure 6. NLRP6 is required for Rap-induced recovery from inﬂammation WT male mice were administered 3% DSS in drinking water for 7 days followed by intraperitoneal (i.p.) injection of saline or the ERB-041 (5 mg/kg body weight) with or without 3-MA (1.5 mg/kg body weight) for 5 days (n = 5). (A) Weight loss of colitis model mice. Data represent mean values ±SEM. **p < 0.01, n.s., not signiﬁcant, by two-way ANOVA with Tukey’s post hoc test. (B) Representative gross photographs and the colon length of different mice. (C) Representative H&E staining of distal colon sections from mice. Scale bars, 200 mm. (D) Tissue IL-1b and TNF-a levels were measured by ELISA.

Techniques: Injection, Saline, Staining, Enzyme-linked Immunosorbent Assay

Journal: Biomedical chromatography : BMC

Article Title: A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine

doi: 10.1002/bmc.3562

Figure Lengend Snippet: Chromatograms of plasma for 5-azacytidine (A) LLOQ (5 ng/mL), (B) predose patient sample, (C) patient sample with 446 ng/mL of 5-azacytidine, and (D) internal standard (5-methyl-2′-deoxycytine).

Article Snippet: 5-azacytidine was obtained from MP Biomedicals (Santa Ana, CA) and 5-methyl-2′-deoxycytidine (5-Me-2′DC), the internal standard, from Chem-Impex International (Wood Dale, IL) ( Supplemental Fig 1 ).

Techniques:

Review

Structured Review

Images

1) Product Images from "A robust and rapid liquid chromatography tandem mass spectrometric method for the quantitative analysis of 5-azacytidine"

Related Articles

other:

Purification:

Similar Products

Image Search Results